COI primers: LCO1490 and HCO2198
Version not yet assigned, updated 2026-09-30. https://dustinedwards.info/research/protocols/coi-primers
- Updated
- 2026-09-30
Reagents
| Reagent | Amount | Source | Notes |
|---|---|---|---|
| GoTaq® Flexi DNA polymerase | Promega, M8296 | ||
| 100 bp DNA ladder | New England Biolabs, N3231 |
Equipment
1% agarose gel in TBE
Primers
| Primer | Set | Direction | Sequence (5′ to 3′) | Product (computed) |
|---|---|---|---|---|
| LCO1490 | COI primers: LCO1490 and HCO2198 | forward | GGTCAACAAATCATAAAGATATTGG | 709 bp |
| HCO2198 | COI primers: LCO1490 and HCO2198 | reverse | TAAACTTCAGGGTGACCAAAAAATCA | 709 bp |
Product sizes are computed from where the primers bind X03240.1 (Drosophila yakuba complete mitochondrial sequence), in the accession’s own coordinates.
Reaction mix
Set up the reaction with the mix recommended for your polymerase. The lab uses Promega GoTaq® Flexi DNA polymerase.
PCR conditions
Run the product on the 1% agarose gel in TBE beside the 100 bp ladder and look for the band at 708 bp.
Expected:The product at 708 bp, next to the 100 bp ladder, in the positive (mtDNA) lane, with no band in the negative lane.