# Pan-avian GAPDH PCR

Pan-avian GAPDH primer sequences and PCR conditions, used as a control that a bird DNA extraction holds amplifiable avian DNA. Product: 534 bp.

- Updated: 2026-09-30
- Scale: 1 reaction

This is the PCR protocol my lab uses to amplify pan-avian GAPDH (glyceraldehyde-3-phosphate dehydrogenase). It serves as a control for avian DNA: a GAPDH band shows that a bird DNA extraction holds DNA that will amplify, so a negative result in a virus PCR such as the [REV PCR](/research/protocols/rev-lpdv-primers) can be trusted.

## Based on

- Olias et al. 2014 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4057121/): primer sequences
- Stewart et al. 2019, J Wildl Dis 55(3) (doi:10.7589/2018-08-187): reaction mix and cycling (cycling in the supplement)
- Cox et al. 2022 (doi:10.7589/JWD-D-22-00023): same cycling

## Reagents

- Nuclease-free water: 5.5 µL per reaction.
- One*Taq* Hot Start 2X Master Mix (New England Biolabs): 12.5 µL per reaction. [NEB One*Taq*® Hot Start 2X Master Mix](https://www.neb.com/products/m0484-onetaq-hot-start-2x-master-mix-with-standard-buffer)
- Forward primer (10 µM stock): 1 µL per reaction; stock 10 µM.
- Reverse primer (10 µM stock): 1 µL per reaction; stock 10 µM.
- Eluted DNA: 5 µL per reaction.

## Equipment

- NEB 100 bp ladder
- 2% agarose gel in TBE

## Primer sequences

| Primer | Sequence (5′ to 3′) |
| --- | --- |
| Forward | `GTGGTGCTAAGCGTGTTATCATC` |
| Reverse | `GGCAGCACCTCTGCCATC` |

The primers are from [Olias et al. 2014](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4057121/) (PMC4057121). The protocol on this page is the one published in [Stewart et al. 2019, J Wildl Dis 55(3)](/research/publications/10-7589-2018-08-187/), with the cycling in that paper's supplement; [Cox et al. 2022](/research/publications/10-7589-jwd-d-22-00023/) used the same cycling.

## Product size

Olias et al. 2014 give the genomic product as 534 bp. The gel shown on the original version of this page marked the product at 534 bp, next to a 100 bp ladder. The positive lane was DNA from DF-1 cells; the negative lane had no band.

## Materials

- [NEB One*Taq*® Hot Start 2X Master Mix](https://www.neb.com/products/m0484-onetaq-hot-start-2x-master-mix-with-standard-buffer)
- [NEB 100 bp ladder](https://www.neb.com/products/n3231-100-bp-dna-ladder)
- 2% agarose gel in TBE

## Reaction mix

From Stewart et al. 2019, for each 25 µL reaction:

| Component | Volume |
| --- | --- |
| Nuclease-free water | 5.5 µL |
| One*Taq* Hot Start 2X Master Mix (New England Biolabs) | 12.5 µL |
| Forward primer (10 µM stock) | 1 µL |
| Reverse primer (10 µM stock) | 1 µL |
| Eluted DNA | 5 µL |

1. Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of One*Taq* Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.

## PCR conditions

Extension temperature is dependent on polymerase. The lab runs the extension at 68 °C for the One*Taq* mix, where Olias et al. 2014 used 72 °C.

| Step | Temperature (°C) | Time |
| --- | --- | --- |
| initial denaturation | 95 | 10 min. |
| 40 cycles | 95 | 30 sec. |
|  | 58 | 60 sec. |
|  | 68 | 30 sec. |
| extension | 68 | 5 min. |
| hold | 10 | ∞ |

2. Run the cycling program in the table above.
3. Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder and look for the band at 534 bp.
   > Expected: A band at 534 bp. On the original version of this page, the positive lane (DNA from DF-1 cells) showed the product at 534 bp and the negative lane had no band.

## Related pages

- [REV PCR primers](/research/protocols/rev-lpdv-primers)
- [REV and LPDV research](/research/retroviruses/avian)
- [COI primers](/research/protocols/coi-primers)

## Expected results

A band at 534 bp beside the 100 bp ladder. Olias et al. 2014 give the genomic product as 534 bp. The gel shown on the original version of this page marked the product at 534 bp; the positive lane was DNA from DF-1 cells, and the negative lane had no band.

## Limitations

Extension temperature is dependent on polymerase: the lab runs the extension at 68 °C for the One*Taq* mix, where Olias et al. 2014 used 72 °C.

## References

- Olias et al. 2014. [PMC4057121](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4057121/)
- Stewart et al. 2019, *J Wildl Dis* 55(3). [doi:10.7589/2018-08-187](https://doi.org/10.7589/2018-08-187). On this site: [Stewart et al. 2019](/research/publications/10-7589-2018-08-187/).
- Cox et al. 2022. [doi:10.7589/JWD-D-22-00023](https://doi.org/10.7589/JWD-D-22-00023). On this site: [Cox et al. 2022](/research/publications/10-7589-jwd-d-22-00023/).