Pan-avian GAPDH PCR
Version not yet assigned, updated 2026-09-30. https://dustinedwards.info/research/protocols/pan-avian-gapdh
- Updated
- 2026-09-30
Reagents
| Reagent | Stock | Amount | For 1 reaction | Source | Notes |
|---|---|---|---|---|---|
| Nuclease-free water | 5.5 µL per reaction | 5.5 µL | Not recorded | ||
| OneTaq® Hot Start 2X Master Mix | 12.5 µL per reaction | 12.5 µL | New England Biolabs, M0484 | ||
| Forward primer (10 µM stock) | 10 µM | 1 µL per reaction | 1 µL | ||
| Reverse primer (10 µM stock) | 10 µM | 1 µL per reaction | 1 µL | ||
| Eluted DNA | 5 µL per reaction | 5 µL | |||
| 100 bp DNA ladder | New England Biolabs, N3231 |
Equipment
2% agarose gel in TBE
Primers
| Primer | Set | Direction | Sequence (5′ to 3′) | Product (computed) |
|---|---|---|---|---|
| Pan-avian GAPDH forward | Pan-avian GAPDH PCR | forward | GTGGTGCTAAGCGTGTTATCATC | 534 bp |
| Pan-avian GAPDH reverse | Pan-avian GAPDH PCR | reverse | GGCAGCACCTCTGCCATC | 534 bp |
Product sizes are computed from where the primers bind NC_052532.1:76902320-76906237 (Gallus gallus isolate bGalGal1 chromosome 1, bGalGal1.mat.broiler.GRCg7b, whole genome shotgun sequence), in the accession’s own coordinates.
Reaction mix
Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of OneTaq Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.
PCR conditions
Run the cycling program in the table above.
Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder and look for the band at the product size listed under Primers.
Expected:A band at the product size listed under Primers in the positive control (DNA from DF-1 cells) and no band in the negative lane.