REV and LPDV PCR primers
Version not yet assigned, updated 2026-09-30. https://dustinedwards.info/research/protocols/rev-lpdv-primers
- Updated
- 2026-09-30
Reagents
| Reagent | Stock | Amount | For 1 reaction | Source | Notes |
|---|---|---|---|---|---|
| Nuclease-free water | 5.5 µL per reaction | 5.5 µL | Not recorded | ||
| OneTaq® Hot Start 2X Master Mix | 12.5 µL per reaction | 12.5 µL | New England Biolabs, M0484 | ||
| Forward primer (10 µM stock) | 10 µM | 1 µL per reaction | 1 µL | ||
| Reverse primer (10 µM stock) | 10 µM | 1 µL per reaction | 1 µL | ||
| Eluted DNA | 5 µL per reaction | 5 µL | |||
| 100 bp DNA ladder | New England Biolabs, N3231 |
Equipment
2% agarose gel in TBE
Primers
| Primer | Set | Direction | Sequence (5′ to 3′) | Product (computed) |
|---|---|---|---|---|
| REV 3′ LTR forward | PCR REV 3′ LTR | forward | CATACTGAGCCAATGGTT | 281 bp at 2 sites |
| REV 3′ LTR reverse | PCR REV 3′ LTR | reverse | AATGTTGTACCGAAGTACT | 281 bp at 2 sites |
| REV pol (protease and reverse transcriptase) forward | PCR REV pol (protease and reverse transcriptase) | forward | CAAATAATAGATTTTCTAGTAGATACGGGA | 574 bp |
| REV pol (protease and reverse transcriptase) reverse | PCR REV pol (protease and reverse transcriptase) | reverse | AGTGGACGGGTCTCAGGA | 574 bp |
| REV pol (reverse transcriptase and integrase) forward | PCR REV pol (reverse transcriptase and integrase) | forward | CGAGAAGTAGCTATACGTCCTTTG | 801 bp |
| REV pol (reverse transcriptase and integrase) reverse | PCR REV pol (reverse transcriptase and integrase) | reverse | ACATCGTGCCCGGAGC | 801 bp |
| LPDV p31/CA forward | PCR LPDV p31/CA | forward | ATGAGGACTTGTTAGATTGGTTAC | 458 bp |
| LPDV p31/CA reverse | PCR LPDV p31/CA | reverse | TGATGGCGTCAGGGCTATTTG | 458 bp |
Product sizes are computed from where the primers bind DQ387450.1, DQ387450.1, DQ387450.1, U09568.1 (Reticuloendotheliosis virus strain APC-566, complete genome; Reticuloendotheliosis virus strain APC-566, complete genome; Reticuloendotheliosis virus strain APC-566, complete genome; Lymphoproliferative disease virus of Meleagris gallopavo Gag precursor, protease p16, Pol precursor, Env precursor, ORF1 and ORF3 genes, complete cds), in the accession’s own coordinates.
Reaction mix
Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of OneTaq Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.
Run the cycling program for the primer set, as in its table below.
Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder.
Expected:A band at the set's product size: see where the REV amplicons sit on the genome and, for LPDV, PCR LPDV p31/CA. The REV-positive lane shows the band and the negative lane none.