---
id: "edwards-2008-tax-repression"
title: "Human T-Cell Leukemia Virus Type 1 Tax Relieves Repression of Proliferating Cell Nuclear Antigen Gene Expression"
authors:
  - "Dustin C. Edwards"
  - "Susan J. Marriott"
venue: "Journal of Virology"
year: 2008
date: "2008-12"
doi: "10.1128/jvi.00356-08"
url: "/research/publications/10-1128-jvi-00356-08/"
pdf: "/research/publications/10-1128-jvi-00356-08/dustin-edwards-10-1128-jvi-00356-08.pdf"
pmc: "https://pmc.ncbi.nlm.nih.gov/articles/PMC2583679/"
openAccess: true
citedBy: 9
citedBySource: "OpenAlex, read 2026-09-12"
---
# Human T-Cell Leukemia Virus Type 1 Tax Relieves Repression of Proliferating Cell Nuclear Antigen Gene Expression

HTLV-1 Tax relieves a repressor on the PCNA promoter, raising PCNA expression.

## Abstract

Human T-cell leukemia virus type 1 (HTLV-1) is the etiological agent of adult T-cell leukemia. The transforming ability of Tax, the viral oncoprotein, is believed to depend on interactions with cell cycle regulators and on transactivation of genes that control cellular proliferation, including proliferating cell nuclear antigen (PCNA), a cofactor associated with DNA replication and repair. Tax associates with cellular transcription factors to alter their affinity for cognate DNA elements, leading to increased or decreased transcription from that promoter. Although it has been demonstrated that Tax transactivates the PCNA promoter, the mechanism of transcriptional activation is unknown. Here we report a cellular complex that binds specifically to a novel site within the minimal Tax-responsive element of the TATAA-less PCNA promoter. Mutation at this binding site or Tax expression inhibited complex formation and increased promoter activity, suggesting that the complex is a transcriptional repressor. The activation of PCNA gene expression by Tax and consequential decrease in nucleotide excision repair mediated by PCNA overexpression could contribute to the reduced DNA repair capacity and genomic instability observed in HTLV-1-infected cells.

## Full text

Machine-extracted from the PDF linked above. It carries the artifacts that come with reading a typeset two-column page: running heads, figure captions in the flow of the prose, and words broken across line ends. The abstract above is the registry's deposit and is the authoritative text.

JOURNAL OF VIROLOGY, Dec. 2008, p. 11714–11722 Vol. 82, No. 23
0022-538X/08/$08.000 doi:10.1128/JVI.00356-08
Copyright © 2008, American Society for Microbiology. All Rights Reserved.
Human T-Cell Leukemia Virus Type 1 Tax Relieves Repression of
Proliferating Cell Nuclear Antigen Gene Expression
Dustin C. Edwards and Susan J. Marriott*
Department of Molecular Virology and Microbiology, Baylor College of Medicine, MS-385, One Baylor Plaza,
Houston, Texas 77030
Received 18 February 2008/Accepted 9 September 2008
Human T-cell leukemia virus type 1 (HTLV-1) is the etiological agent of adult T-cell leukemia. The
transforming ability of Tax, the viral oncoprotein, is believed to depend on interactions with cell cycle
regulators and on transactivation of genes that control cellular proliferation, including proliferating cell
nuclear antigen (PCNA), a cofactor associated with DNA replication and repair. Tax associates with cellular
transcription factors to alter their affinity for cognate DNA elements, leading to increased or decreased
transcription from that promoter. Although it has been demonstrated that Tax transactivates the PCNA
promoter, the mechanism of transcriptional activation is unknown. Here we report a cellular complex that
binds specifically to a novel site within the minimal Tax-responsive element of the TATAA-less PCNA pro-
moter. Mutation at this binding site or Tax expression inhibited complex formation and increased promoter
activity, suggesting that the complex is a transcriptional repressor. The activation of PCNA gene expression by
Tax and consequential decrease in nucleotide excision repair mediated by PCNA overexpression could con-
tribute to the reduced DNA repair capacity and genomic instability observed in HTLV-1-infected cells.
Human T-cell leukemia virus type 1 (HTLV-1) is the etio-
logical agent of adult T-cell leukemia (ATL), a disease char-
acterized by malignant proliferation of CD4 T lymphocytes.
An estimated 10 to 20 million people worldwide are infected
with HTLV-1 (6), but only a small percentage of HTLV-1-
infected individuals develop ATL (11, 16, 22, 30). Disease
onset occurs after a long period of clinical latency, consistent
with a multistep process of T-lymphocyte immortalization and
transformation. HTLV-1 is also associated with other clinical
disorders, including tropical spastic paraparesis/HTLV-1-asso-
ciated myelopathy, HTLV-1-associated arthropathy, HTLV-1-
associated uveitis, infective dermatitis, and polymyositis (2, 8,
21, 26). The mechanism by which infected individuals develop
ATL is unknown, but the accumulation of DNA damage in
HTLV-transformed cells has been associated with the viral
oncoprotein, Tax (20).
HTLV-1 Tax is essential for viral gene expression and also
regulates the expression of cellular genes involved in prolifer-
ation and regulation of cellular processes, including pathways
involved in cell cycle regulation, apoptosis, and DNA damage
responses. Microarray analyses have identified over 300 genes
that are upregulated in Tax-expressing cells (5, 23), including
that encoding proliferating cell nuclear antigen (PCNA), a
sliding clamp that affects DNA replication and repair. Since
Tax does not bind DNA directly, its ability to transactivate
promoters depends on interactions with cellular transcription
factors and coactivators. These interactions can alter the DNA
binding affinity and specificity of cellular DNA binding pro-
teins (14). Tax has been shown to activate gene expression
through cyclic AMP response element and activating transcrip-
tion factor-1 (CRE/ATF-1), nuclear factor B (NF-B), and
serum response element (SRE) pathways. We have previously
shown that Tax is able to transactivate the PCNA promoter
(18, 24) to increase endogenous PCNA protein expression (12,
13). Although a Tax-responsive element (TRE) of the PCNA
promoter was identified, the mechanism of Tax transactivation
of this promoter is currently unknown. Analysis of Tax mutant
proteins demonstrated that transactivation of the PCNA pro-
moter did not require the CRE or NF-B pathways (18, 24).
The PCNA promoter TRE contains no direct homology to any
known cellular transcription factor binding sites or to any pre-
viously determined TREs. Identification of a cellular pro-
tein(s) that binds to the PCNA TRE and further characteriza-
tion of TRE function would advance our understanding of how
Tax regulates the expression of this important gene.
In this study, we examined Tax-mediated transactivation of
the PCNA promoter. TATAA-binding protein (TBP) was
shown to associate specifically with a novel transcription factor
site within the minimal TRE of the TATAA-less PCNA pro-
moter. The TBP-TRE complex was a moderate repressor of
transcription, and Tax expression disrupted formation of this
complex. Disruption of the repressive TBP complex at the
PCNA promoter could contribute to the increased PCNA ex-
pression that is observed in Tax-expressing cells. PCNA over-
expression has been shown to repress nucleotide excision re-
pair (12, 13, 18), which may provide a mechanism by which Tax
can suppress DNA repair and contribute to cellular transfor-
mation.
MATERIALS AND METHODS
Cell lines. 293 cells were maintained in Dulbecco’s modified Eagle’s medium
supplemented with 10% fetal bovine serum. Jurkat, CEM, MS-9, and MT-2 cells
were maintained in RPMI medium supplemented with 10% fetal bovine serum.
MT-2 cells were also supplemented with interleukin-2 (100 U/ml).
* Corresponding author. Mailing address: Department of Molecular
Virology and Microbiology, Baylor College of Medicine, MS-385, One
Baylor Plaza, Houston, TX 77030. Phone: (713) 798-4440. Fax: (713)
798-4435. E-mail: susanm@bcm.edu.
 Published ahead of print on 17 September 2008.
11714
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

Plasmids and oligonucleotides. Oligonucleotides were synthesized by Sigma-
Genosys. The PCNA promoter probes used for electrophoretic mobility shift
assay (EMSA) analysis are listed in Table 1. The c-fos SRE oligonucleotide was
described previously (29). The TBP consensus binding site oligonucleotide sense
strand was 5-GCAGAGCATATAAAATGAGGTAGGA-3. The multimerized
PCNA promoter elements used for promoter activation assays were as follows:
2X 21 to 1, 5-TCGAGCGCGCTTGCGGACGCGGCGGCTAGACGCGC
TTGCGGACGCGGCGGCATTAAACGGTTA-3; 2X  PIR, 5-TCGAGAC
ATCTTGCGGACGCGGCGGCTAGAACATCTTGCGGACGCGGCGGCA
TTAAACGGTTA-3; and 2X  PDR, 5-TCGAGCGCGCTTGCGATCTGG
G C G G C T A G A C G C G C T T G C GATCT GG G C G G C A T T A A A C G G T T
A-3 (underlined sequences identify the positions of mutations). The PCNA
promoter luciferase reporter plasmids 2X 21 to 1, 2X  PIR, and 2X  PDR
were made by ligating the multimerized PCNA promoter elements into the
promoterless pGL3 basic luciferase reporter plasmid between the XbaI and
HindIII cloning sites. The Tax and negative control expression plasmids were
pCMV-Tax and pCMV-1 and were described previously (25). pGL3 basic and
pRL-SV40, an internal control reporter, were purchased from Promega (Madi-
son, WI).
Transfections. 293 cells at approximately 50% to 80% confluence were trans-
fected using Lipofectamine reagent (Invitrogen, Carlsbad, CA) as directed by the
manufacturer.
Whole-cell extract preparation. Approximately 5 106 cells were washed in 0.5
volume of cold 0.01 M phosphate-buffered saline and pelleted. Cells were incu-
bated in an equal volume of RIPA buffer (10 mM Tris, pH 7.4, 150 mM NaCl,
1% sodium deoxycholate, 1% Triton X) on ice for 20 min and centrifuged. The
supernatant was collected, and protein concentrations were determined by Brad-
ford assay.
EMSAs. Double-stranded oligonucleotides were labeled with [-32P]dCTP by
use of Klenow enzyme (Invitrogen, Carlsbad, CA). EMSA reaction mixtures
included 5 EMSA buffer (50 mM HEPES, pH 7.9, 250 mM KCl, 12.5 mM
MgCl, 12.5% glycerol, 5 mM EDTA), 1 mM dithiothreitol, 1 mM phenylmeth-
ylsulfonyl fluoride, 1 g sheared salmon sperm DNA (Sigma), 10 g whole-cell
extract, and approximately 1  109 to 3  109 M labeled probe (30 kcpm) in
a 20-l total reaction volume. Reaction mixtures were incubated at room tem-
perature for 20 min. Complexes were resolved in a 4% nondenaturing poly-
acrylamide gel in 0.6 Tris-borate-EDTA at 4°C at 155 V for 3.5 h. For
competition assays, an approximately 150-fold molar excess of unlabeled oligo-
nucleotide was added to the reaction mix, except where indicated. For antibody
interference assays, 10 g of whole-cell extract was preincubated with or without
0.5 g antibody at 4°C for 1 h.
Antibodies. Horseradish peroxidase-conjugated secondary antibodies and an-
tibodies to actin (Sigma, St. Louis, MO), TFIID (TBP), and E2F-6 (Santa Cruz
Biotechnology, Santa Cruz, CA) were purchased. A rabbit polyclonal antibody
against Tax (568) was previously described (7).
Western blots. One hundred micrograms of each sample was boiled with 4
sodium dodecyl sulfate-polyacrylamide gel electrophoresis sample buffer. Sam-
ples were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(10%), transferred to a nitrocellulose membrane, and incubated with antibodies
against Tax or actin. The membrane was then incubated with the appropriate
horseradish peroxidase-conjugated secondary antibody. Immunoreactivity was
detected with SuperSignal West Pico chemiluminescent substrate (Pierce, Rock-
ford, IL).
Promoter activation assays. 293 cells were distributed in 12-well plates and
transfected with 1 ng of pRL-SV40 (to control for transfection efficiency) and 0.2
g of pGL3 basic plasmid, 2X 21 to 1, 2X  PIR, or 2X  PDR luciferase
reporter plasmid. Twenty-four hours after transfection, cells were lysed in passive
lysis buffer (Promega, Madison, WI), and luciferase activity was measured using
a dual-luciferase reporter assay system (Promega, Madison, WI). Luciferase
activity was normalized to Renilla luciferase activity from the same well. Nor-
malized luciferase activity from cells transfected with pGL3 basic was set to
100% activity, and luciferase values for each test plasmid were normalized to this
value. For Tax transactivation assays, luciferase reporter plasmids were cotrans-
fected with either 2 g pCMV-Tax or sheared salmon sperm DNA, and cells
were lysed and luciferase activity measured as described before, but 48 h after
transfection. The degree of activation was determined by calculating the change
in activity of each reporter in Tax-expressing cells compared to the activity in
mock-transfected cells. Normalized luciferase activity from cells transfected with
2X 21 to 1 was set to 100% transactivation, and luciferase values for each test
plasmid were normalized to this value.
RESULTS
A previously uncharacterized protein complex forms on the
PCNA promoter. We have previously shown that the HTLV-1
Tax protein can transactivate the PCNA promoter (18, 24) to
increase endogenous PCNA protein expression (12, 13). The
minimum Tax-responsive region of the PCNA promoter was
localized to a complex repeat element spanning nucleotides
45 to 7 (Fig. 1A) and is flanked by CRE/ATF-1 and RFX1
sites at the 5 end and a YY1 site at the 3 end (17, 24). This
complex element contains an imperfect inverted repeat adja-
cent to a perfect direct repeat (ACGCGGCG). The GC-rich
direct and indirect repeats have no obvious similarity to any
characterized transcription factor binding site or to any previ-
ously determined TRE. The PCNA promoter does not contain
a TATAA box to initiate RNA transcription. However, YY1
binding, together with histone H4 acetylation, can initiate tran-
scriptional activation (27). We previously demonstrated that
Tax transactivation of the PCNA promoter does not require
CRE or NF-B response elements (18, 24).
To determine whether a previously uncharacterized complex
forms on the Tax-responsive region of the PCNA promoter, a
proximal element probe, spanning nucleotides 21 to 1, or a
distal element probe, spanning nucleotides 48 to 30, was
incubated with whole-cell extracts and analyzed by EMSA.
Two complexes formed on the proximal element (Fig. 1B, lane
2), while only a single complex formed on the distal element
(Fig. 1B, lane 7). To determine the specificity of the complexes,
unlabeled competitor oligonucleotides for each probe (Fig. 1B,
lanes 3, 4, 8, and 9) or an oligonucleotide with a mutation in
the proximal inverted repeat ( PIR) (Fig. 1B, lanes 5 and 10)
was added to the indicated reactions. The proximal element
(lane 3) competed for binding to the slowest-migrating com-
plex (Fig. 1B, arrowhead). Since the distal element (lane 4)
or proximal element (lane 5) mutant showed little or no
competition for complex formation (Fig. 1B), the slower-
migrating complex is considered to bind specifically to the
proximal element.
Promoter mutations inhibit formation of the specific com-
plex. To further analyze this novel complex, mutations were
introduced into the proximal element and their effect on bind-
ing activity was examined by EMSA. The wild-type proximal
element, the proximal element containing a mutation of nu-
TABLE 1. Sense sequence of oligonucleotides used for EMSA analysis
Oligonucleotide Position Sequence (5–3)a
Minimal TRE 59 to 1 TCGAGCGTGGTGACGTCGCAA
CGCGGCGCAGGGTGAGAGC
GCGCGCTTGCGGACGCGGC
GGCAT
Distal 48 to 30 CTAGAGTCGCAACGCGGCGCA
GGGA
Proximal 21 to 1 CTAGACGCGCTTGCGGACGCG
GCGGCT
 PIR 21 to 1 CTAGAACATCTTGCGGACGCG
GCGGCT
 PDR 21 to 1 CTAGACGCGCTTGCGATCTGG
GCGGCT’
a Sequences in bold identify the positions of the inverted and direct repeats.
Underlined sequences identify the positions of mutations.
VOL. 82, 2008 REGULATION OF PCNA EXPRESSION BY HTLV-1 Tax 11715
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

cleotides 21 to 18 overlapping the inverted repeat ( PIR),
or the proximal element containing mutations within nucleo-
tides 11 to 7 in the direct repeat ( PDR) was used as a
probe. Complex formation was observed on the wild-type prox-
imal element and the proximal element with a mutation in the
direct repeat (Fig. 1C, lanes 2 and 6). However, mutation of
the inverted repeat disrupted complex formation (Fig. 1C, lane
4). This result is consistent with the inability of  PIR to
compete for specific binding on the wild-type proximal element
(Fig. 1B, lane 5). The  PIR mutant also did not compete for
complex formation on the larger PCNA promoter TRE probe
(Fig. 1D, lane 4). Taken together, these results suggest that a
previously uncharacterized DNA-protein complex (PIR) binds
specifically to the 5 end of the inverted repeat within the
proximal PCNA promoter element.
Tax interferes with PIR complex formation on the proximal
TRE of the PCNA promoter. The association of Tax with
cellular transcription factors has been shown to alter their
affinity for cognate DNA elements, leading to increased or
decreased transcription from that promoter (14). To deter-
mine the effect of Tax on the PIR complex, 293 cells were
transfected with increasing amounts of a vector encoding
Tax or the empty parental plasmid. Tax protein levels were
measured by immunoblotting (Fig. 2A), and formation of
the PIR complex on the proximal PCNA promoter was
measured by EMSA. A dose-dependent decrease in complex
formation was observed in Tax-expressing cells (Fig. 2B,
lanes 3 to 5) but not in mock-transfected cells or cells
transfected with empty plasmid (Fig. 2B, lanes 2 and 6).
Densitometric analyses of three independent experiments
FIG. 1. Formation of a specific protein complex on the PCNA promoter. (A) Schematic diagram of the PCNA promoter. Distal and proximal
TREs are highlighted, and sequences are shown below (dashed lines, inverted repeats; solid lines, direct repeats). (B) EMSA using 32P-labeled
proximal (lanes 1 to 5) or distal (lanes 6 to 10) probes incubated with 293 whole-cell extract (WCE) (lanes 2 to 5 and 7 to 10). Unlabeled competitor
oligonucleotides (150-fold excess) were added as indicated above (lanes 3 to 5 and 8 to 10). The location of the specific complex is indicated on
the left. (C) EMSA using 32P-labeled probes (lanes 1 and 2, proximal element; lanes 3 and 4, proximal element with a mutation in the inverted
repeat; and lanes 5 and 6, proximal element with a mutation in the direct repeat) incubated with 293 whole-cell extract (lanes 2, 4, and 6). The
position of the specific complex is indicated on the left. (D) EMSA using a 32P-labeled probe (ATF 57 to 11) (lanes 1 to 4) incubated with
293 whole-cell extract (lanes 2 to 4). Unlabeled competitor oligonucleotides (150-fold excess) were added as indicated above (lanes 3 and 4). The
positions of the RFX1 and specific complexes are indicated on the left.
11716 EDWARDS AND MARRIOTT J. VIROL.
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

(Fig. 2C) demonstrated that the PIR complex was reduced
approximately 67% in cells transfected with the largest
amount of Tax.
To determine whether the decrease in PIR complex for-
mation induced by Tax was specific, 293 cells were trans-
fected with a Tax expression plasmid or the empty parental
plasmid, and whole-cell extracts were prepared and ana-
lyzed by EMSA (Fig. 2D). Since Tax is known to interact
FIG. 2. Transient Tax expression interferes with PIR complex formation on the proximal PCNA promoter TRE. (A) Western blot of 293 whole-cell extracts
from mock-transfected cells (lane 1) or cells transfected with increasing amounts of pCMV-Tax (lanes 2 to 4) or pCMV-1 (lane 5), using antibodies to Tax or
actin as indicated. (B) EMSA using 32P-labeled proximal probe (lanes 1 to 6) incubated with whole-cell extracts from mock-transfected cells (lane 2) or 293 cells
transfected with increasing amounts of pCMV-Tax (lanes 3 to 5) or pCMV-1 (lane 6). The position of the specific complex is indicated on the left.
(C) Densitometric volume analyses of samples from panel B quantitated with ImageQuant software. Each reaction signal from the specific complex was divided
by the total signal and normalized to mock-transfected cells. Error bars represent the standard errors of the means for three independent experiments. *,
significant difference in specific complex formation between Tax-negative and Tax-positive cells (Student t test; P 0.05). (D) EMSA using 32P-labeled proximal
(lanes 1 to 4) or c-fos SRE (lanes 5 and 6) probe incubated with whole-cell extracts from mock-transfected cells (lanes 2 and 6) or 293 cells transfected with 2
g pCMV-Tax (lanes 4 and 7) or pCMV-1 (lanes 5 and 8). The position of the specific proximal complex is indicated on the left, and the position of the specific
SRE complex is indicated on the right (arrowheads).
VOL. 82, 2008 REGULATION OF PCNA EXPRESSION BY HTLV-1 Tax 11717
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

with SRF to enhance its binding to SREs located within the
c-fos promoter (28, 29), the c-fos promoter SRE was used as
a control. Tax expression disrupted formation of the PIR
complex on the 21 to 1 proximal element probe (Fig. 2D,
lane 3). In contrast, the binding of SRF to the c-fos SRE
probe was enhanced in Tax-expressing cells (Fig. 2D, lane
7), demonstrating that the inhibitory effect of Tax on PIR
complex formation was specific. In addition, extracts from
human T cells that stably express Tax (Fig. 3B, lanes 4 and
5) also showed less PIR complex formation than did extracts
from cells that do not express Tax (Fig. 3B, lanes 2 and 3).
Quantitation of the EMSA bands is shown in Fig. 3C, and a
Western blot showing Tax expression in these extracts is
shown in Fig. 3A.
TBP is a component of the proximal TRE binding complex.
Labrie et al. resolved multiple EMSA complexes with a
probe spanning nucleotides 87 to 62 of the PCNA pro-
moter and coding region (17). Each complex bound the
probe specifically, and their supershift analyses identified
ATF-1, RFX1, and YY1 as components of these complexes.
Although the PCNA promoter does not contain a consensus
TATAA box, competitor assays using an unlabeled oligonu-
cleotide containing the adenovirus major late promoter
TATAA box reduced the formation of an uncharacterized
complex, suggesting that general transcription factors such
as TBP can associate with the PCNA promoter and play a
role in regulating PCNA transcription. However, several
mutations within the PCNA promoter, including one at po-
sitions 27 to 20 to disrupt any potential TATAA ele-
ment, did not affect complex formation, so the association of
TBP with the PCNA promoter is likely to be indirect.
Tax has been shown to directly interact with TBP (3), and
specific Tax mutants that fail to bind TBP also fail to sup-
press nucleotide excision repair (18). The position of a pu-
tative TATAA box (TGAGA) at nucleotides 29 to 25 is
very close to the PCNA promoter PIR, which is required for
formation of the PIR complex identified above. Therefore,
we investigated whether TBP contributes to formation of
this complex. To address this question, we asked whether a
TBP-specific antibody could affect formation of the PIR
complex. An antibody to TBP disrupted the complex (Fig.
4A, lane 3), while a control antibody to E2F-6 did not affect
the complex (Fig. 4A, lane 4). An unlabeled consensus TBP
binding site oligonucleotide competed for specific complex
formation on the PCNA promoter, in a dose-dependent
manner (Fig. 4C, lanes 3 to 5). However, since TBP is
relatively abundant in cells, 100- to 400-fold excess compet-
itor was required to compete for complex formation. These
results suggest that TBP is part of the PIR complex that
forms on the PCNA promoter-proximal TRE.
TBP negatively regulates the PCNA initiator element.
The ability of Tax to diminish formation of the TBP-con-
FIG. 3. Stable Tax expression in T cells interferes with PIR complex formation on the proximal PCNA promoter TRE. (A) Western blot of
whole-cell extracts from Jurkat (lane 1), CEM (lane 2), MS-9 (lane 3), and MT-2 (lane 4) T cells, using antibodies to Tax or actin as indicated.
(B) EMSA using 32P-labeled proximal probe (lanes 1 to 5) incubated with whole-cell extract from Jurkat (lane 2), CEM (lane 3), MS-9 (lanes 4),
or MT-2 (lane 5) T cells. The position of the specific complex is indicated on the left. (C) Densitometric volume analyses of the samples from panel
B quantitated with ImageQuant software. Each reaction signal from the specific complex was divided by the total signal and normalized to that
of Jurkat T cells. Error bars represent the standard errors of the means for two independent experiments. *, significant difference in specific
complex formation between Tax-negative and Tax-positive cells (Student t test; P 0.05).
11718 EDWARDS AND MARRIOTT J. VIROL.
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

taining complex raised the possibilities that the PIR com-
plex may negatively regulate the PCNA promoter and that
this negative regulation may be relieved by Tax. To charac-
terize the effect of the PIR binding site on basal activity of
the PCNA initiator element, two copies of either the wild-
type proximal PCNA promoter TRE (2X 21 to 1) or the
proximal elements containing mutations in the inverted (2X
 PIR) or direct (2X  PDR) repeats were cloned upstream
of the PCNA initiator. The wild-type proximal element and
2X  PDR showed similarly low PCNA promoter activities
(Fig. 5). However, mutation of the inverted repeat (2X 
PIR), which disrupts PIR complex formation, resulted in
45% more PCNA promoter activity than that with the wild-
type proximal element. This modest increase in transcrip-
tion is similar to levels of Tax transactivation of the PCNA
promoter reported in previous studies (18, 24).
Promoter mutations diminish Tax transactivation. To de-
termine whether the PIR binding site was Tax responsive, a
reporter plasmid containing the multimerized wild-type
proximal PCNA promoter element or constructs containing
mutations in the inverted (2X  PIR) or direct (2X  PDR)
repeats were cotransfected with or without Tax. Mutation of
the inverted repeat (2X  PIR) diminished Tax transactiva-
tion (Fig. 6A). Since this mutation disrupted formation of
the PIR complex, this result was anticipated. Interestingly,
mutation of the adjacent GC-rich direct repeat (2X  PDR)
also diminished Tax transactivation even though the  PDR
mutant did not compete for formation of the PIR complex
(Fig. 1C). To examine whether the direct repeat affected the
ability of Tax to disrupt PIR complex formation, cells were
transfected with Tax or an empty parental plasmid. Tax
protein levels were measured by immunoblotting (Fig. 6B),
and formation of the PIR complex on the wild-type proximal
or  PDR PCNA promoter probe was measured by EMSA.
Decreased PIR complex formation on the wild-type probe
was again observed in Tax-expressing cells (Fig. 6C, lane 3)
but not in mock-transfected cells or cells transfected with
FIG. 4. TBP forms a complex on the PCNA promoter-proximal TRE. (A) EMSA using a 32P-labeled proximal probe (lanes 1 to 6) was
performed with 293 cell whole-cell extract (lanes 2 to 4). Antibodies to TBP or E2F-6 were added as indicated (lanes 3 to 6). The position of the
specific complex is indicated on the left. (B) Densitometric volume analyses of the samples from panel A quantitated with ImageQuant software.
Each reaction signal from the specific complex was divided by the total signal and normalized to reactions in the absence of antibody. Error bars
represent the standard errors of the means for three independent experiments. *, significant difference in specific complex formation between
reactions with and without antibody to TBP (Student t test; P 0.05). (C) EMSA using a 32P-labeled proximal probe (lanes 1 to 5) incubated with
293 whole-cell extract (lanes 2 to 5). Increasing amounts of unlabeled TBP consensus competitor oligonucleotide (100-, 200-, and 400-fold excess)
were added (lanes 3 to 5). The position of the specific complex is indicated on the left.
FIG. 5. TBP binding site negatively regulates the PCNA initiator
element. Two copies of either wild-type proximal TRE (2X 21 to
1),  PIR, or  PDR sequences in a luciferase reporter plasmid were
cotransfected with the pRL-SV40 Renilla reporter plasmid into 293
cells. Luciferase activity was normalized to Renilla luciferase activity
from the same well. Error bars represent the standard errors of the
means for three independent experiments performed in duplicate. *,
significant difference in normalized luciferase activity between cells
transfected with 2X  PIR and cells transfected with empty plasmid
(Student t test; P 0.05).
VOL. 82, 2008 REGULATION OF PCNA EXPRESSION BY HTLV-1 Tax 11719
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

empty plasmid (Fig. 6C, lanes 2 and 4). Interestingly, mu-
tation of the direct repeat abrogated the ability of Tax to
disrupt PIR complex formation (Fig. 6C, lane 7). These
results suggest that the PIR binding site, together with
downstream direct repeat sequences, is required for Tax to
interfere with PIR complex formation and to transactivate
the PCNA promoter.
DISCUSSION
The experimental results presented herein extend our un-
derstanding of Tax-mediated transactivation of the TATAA-
less PCNA promoter. The PIR complex was shown to contain
TBP and to be a moderate repressor of transcription via an
element located at the 5 end of the PCNA promoter-proximal
FIG. 6. TBP binding site negatively regulates the PCNA initiator element. (A) Two copies of either wild-type proximal TRE (21 to 1), 
PIR, or  PDR sequences in a luciferase reporter plasmid were cotransfected into 293 cells together with the pRL-SV40 Renilla luciferase reporter
plasmid and either pCMV-Tax or sheared salmon sperm DNA. Luciferase activity was normalized to Renilla luciferase activity from the same well.
Error bars represent the standard errors of the means for two independent experiments performed in duplicate. *, significant difference in
normalized luciferase activity between cells transfected with 2X  PIR or 2X  PDR and cells transfected with wild-type 2X 21 to 1 plasmid
(Student t test; P 0.05). (B) Western blot of 293 whole-cell extracts from mock-transfected cells (lane 1) or cells transfected with pCMV-Tax
(lane 2) or pCMV-1 (lane 3), using antibodies to Tax or actin as indicated. (C) EMSA using a 32P-labeled proximal probe (lanes 1 to 6) incubated
with whole-cell extracts from mock-transfected cells (lane 2) or 293 cells transfected with pCMV-Tax (lane 3) or pCMV-1 (lane 4). The position
of the specific complex is indicated on the left. (D) Densitometric volume analyses of the samples from panel C quantitated with ImageQuant
software. Each reaction signal from the specific complex was divided by the total signal and normalized to that of mock-transfected cells. Error
bars represent the standard errors of the means for three independent experiments. *, significant difference in specific complex formation between
Tax-negative and Tax-positive cells (Student t test; P 0.05).
11720 EDWARDS AND MARRIOTT J. VIROL.
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

TRE inverted repeat. We further demonstrated that Tax ex-
pression disrupts the PIR complex and that disruption of this
complex leads to increased transcription from the PCNA ini-
tiator. These results suggest that full Tax responsiveness of the
PCNA promoter requires the entire proximal element, inclu-
sive of the direct and inverted repeats. The TRE includes the
novel PIR binding site that begins at the GC-rich region up-
stream of the imperfect PIR and extends into the inverted
repeat (base pairs 21 to 13). The downstream, GC-rich
proximal direct repeat (base pairs 10 to 3) also contributes
to Tax transactivation of the PCNA promoter.
The mechanism of transactivation of the PCNA promoter
by HTLV-1 Tax is unique from those of other viral proteins.
Adenovirus E1A 243R protein relieves the repressive effects
of the RFX1-p107 complex by interacting with the retino-
blastoma-like tumor suppressor protein p107 to disrupt
complex formation on the PCNA E1A-responsive element
at base pairs 59 to 45 (19). Hepatitis B virus X protein
has been shown to physically occupy the CREB-binding
element of the PCNA promoter to recruit p300 and syner-
gistically enhance CREB activity and CREB phosphoryla-
tion by protein kinase A (4).
One mechanism by which Tax could target and transacti-
vate the PCNA promoter at the TRE is by interacting with
TBP. Binding of Tax to TBP may result in conformational
changes that reduce the stability of the PIR complex on the
PCNA promoter, thereby relieving negative regulation. The
repressive effect of TBP on PCNA transcription is likely to
involve factors such as negative coregulator 2 (NC2) (15) as
a component of the TBP complex. NC2 represses RNA
polymerase II transcription by binding to TBP and inhibiting
TFIIA and TFIIB (10). NC2 also affects the sequence spec-
ificity of TBP for TATAA-box binding (9) and has been
found to be associated with a large number of human pro-
moters, including the PCNA promoter (1). It is also possible
that Tax may recruit an undetected complex to the GC-rich
PCNA promoter direct repeat which may hinder complex
formation on the indirect repeat.
Tax-mediated disruption of the repressive PIR complex
on the PCNA promoter opens the possibility that Tax can
affect other TATAA-less promoters. Genome-scale compu-
tational analyses have indicated that approximately 76% of
human core promoters lack TATAA-like elements and have
a high GC content (27) similar to that of the PCNA pro-
moter TRE. The release of TBP from the PCNA promoter
may also contribute to PCNA activation in other forms of
cancer.
Although we hypothesize that suppression of DNA repair
may play a critical role in the transformation of Tax-expressing
cells, factors other than PCNA are certainly involved in the
transformation process. HTLV-1 Tax has been shown to up-
regulate over 300 genes (5, 23), several of which have been
implicated as having roles in cellular transformation. Contin-
ued study and characterization of the effects of Tax on PCNA
expression and function will increase our understanding of
Tax-mediated cellular immortalization and transformation.
Analysis of Tax-mediated transactivation of the PCNA pro-
moter has demonstrated that the TBP-TRE complex is a mod-
erate repressor of transcription and that Tax expression can
disrupt this complex.
ACKNOWLEDGMENTS
We thank members of the Marriott lab for helpful discussions and
support.
These studies were supported by Public Health Service grants CA-
55684 and CA-77371, awarded to S.J.M., from the National Cancer
Institute. D.C.E. was supported in part by NIH training grant T32
AI-07471.
REFERENCES
1. Albert, T. K., K. Grote, S. Boeing, G. Stelzer, A. Schepers, and M. Meister-
ernst. 2007. Global distribution of negative cofactor 2 subunit-alpha on
human promoters. Proc. Natl. Acad. Sci. USA 104:10000–10005.
2. Buggage, R. R. 2003. Ocular manifestations of human T-cell lymphotropic
virus type 1 infection. Curr. Opin. Ophthalmol. 14:420–425.
3. Caron, C., R. Rousset, C. Beraud, V. Moncollin, J. M. Egly, and P. Jalinot.
1993. Functional and biochemical interaction of the HTLV-I Tax1 transac-
tivator with TBP. EMBO J. 12:4269–4278.
4. Cougot, D., Y. Wu, S. Cairo, J. Caramel, C. A. Renard, L. Levy, M. A.
Buendia, and C. Neuveut. 2007. The hepatitis B virus X protein functionally
interacts with CREB-binding protein/p300 in the regulation of CREB-me-
diated transcription. J. Biol. Chem. 282:4277–4287.
5. de La Fuente, C., L. Deng, F. Santiago, L. Arce, L. Wang, and F. Kashanchi.
2000. Gene expression array of HTLV type 1-infected T cells: up-regulation
of transcription factors and cell cycle genes. AIDS Res. Hum. Retrovir.
16:1695–1700.
6. Edlich, R. F., L. G. Hill, and F. M. Williams. 2003. Global epidemic of
human T-cell lymphotrophic virus type-I (HTLV-I): an update. J. Long
Term Eff. Med. Implants 13:127–140.
7. Gatza, M. L., and S. J. Marriott. 2006. Genotoxic stress and cellular stress
alter the subcellular distribution of human T-cell leukemia virus type 1 Tax
through a CRM1-dependent mechanism. J. Virol. 80:6657–6668.
8. Gessain, A., F. Barin, J. C. Vernant, O. Gout, L. Maurs, A. Calander, and G.
DeThe. 1985. Antibodies to human T-lymphotropic virus type I in patients
with tropical spastic paraparesis. Lancet ii:407–409.
9. Gilfillan, S., G. Stelzer, E. Piaia, M. G. Hofmann, and M. Meisterernst.
2005. Efficient binding of NC2. TATA-binding protein to DNA in the ab-
sence of TATA. J. Biol. Chem. 280:6222–6230.
10. Goppelt, A., G. Stelzer, F. Lottspeich, and M. Meisterernst. 1996. A mech-
anism for repression of class II gene transcription through specific binding of
NC2 to TBP-promoter complexes via heterodimeric histone fold domains.
EMBO J. 15:3105–3116.
11. Hinuma, Y., K. Nagata, M. Misoka, T. Nakai, T. Matsumoto, K. Kiroshita,
S. Shirakwa, and I. Miyoshi. 1981. Adult T-cell leukemia: antigen in ATL
cell line and detection of antibodies to the antigen in human sera. Proc. Natl.
Acad. Sci. USA 78:6476–6480.
12. Kao, S. Y., and S. J. Marriott. 1999. Disruption of nucleotide excision repair
by the human T-cell leukemia virus type 1 Tax protein. J. Virol. 73:4299–
4304.
13. Kao, S. Y., and S. J. Marriott. 2000. Suppression of DNA repair by HTLV-I
Tax is rescued by a functional p53 signaling pathway. J. Biol. Chem. 275:
35926–35931.
14. Kashanchi, F., and J. N. Brady. 2005. Transcriptional and post-transcrip-
tional gene regulation of HTLV-1. Oncogene 24:5938–5951.
15. Kim, T. K., Y. Zhao, H. Ge, R. Bernstein, and R. G. Roeder. 1995. TATA-
binding protein residues implicated in a functional interplay between nega-
tive cofactor NC2 (Dr1) and general factors TFIIA and TFIIB. J. Biol.
Chem. 270:10976–10981.
16. Kondo, T., H. Kono, H. Nonaka, N. Miyamoto, R. Yoshida, F. Bando, H.
Inoue, I. Miyoshi, Y. Hinuma, and M. Hanaoka. 1987. Risk of adult T-cell
leukaemia/lymphoma in HTLV-I carriers. Lancet ii:159.
17. Labrie, C., B. H. Lee, and M. B. Mathews. 1995. Transcription factors
RFX1/EF-C and ATF-1 associate with the adenovirus E1A-responsive ele-
ment of the human proliferating cell nuclear antigen promoter. Nucleic
Acids Res. 23:3732–3741.
18. Lemoine, F. J., S. Y. Kao, and S. J. Marriott. 2000. Suppression of DNA
repair by HTLV-I Tax correlates with Tax transactivation of PCNA gene
expression. AIDS Res. Hum. Retrovir. 16:1623–1627.
19. Liu, M., B. H. Lee, and M. B. Mathews. 1999. Involvement of RFX1 protein
in the regulation of the human proliferating cell nuclear antigen promoter.
J. Biol. Chem. 274:15433–15439.
20. Marriott, S. J., and O. J. Semmes. 2005. Impact of HTLV-I Tax on cell cycle
progression and the cellular DNA damage repair response. Oncogene 24:
5986–5995.
21. Nicot, C., R. L. Harrod, V. Ciminale, and G. Franchini. 2005. Human T-cell
leukemia/lymphoma virus type 1 nonstructural genes and their functions.
Oncogene 24:6026–6034.
22. Osame, M., K. Usuku, S. Izumo, N. Ijichi, H. Amitani, A. Igata, M. Matsu-
moto, and M. Tara. 1986. HTLV-I associated myelopathy, a new clinical
entity. Lancet i:1031–1032.
23. Pise-Masison, C. A., M. Radonovich, R. Mahieux, P. Chatterjee, C. White-
VOL. 82, 2008 REGULATION OF PCNA EXPRESSION BY HTLV-1 Tax 11721
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

ford, J. Duvall, C. Guillerm, A. Gessain, and J. N. Brady. 2002. Transcription
profile of cells infected with human T-cell leukemia virus type I compared
with activated lymphocytes. Cancer Res. 62:3562–3571.
24. Ressler, S., G. F. Morris, and S. J. Marriott. 1997. Human T-cell leukemia
virus type 1 Tax transactivates the human proliferating cell nuclear antigen
promoter. J. Virol. 71:1181–1190.
25. Smith, M. R., and W. C. Greene. 1990. Identification of HTLV-I tax trans-
activator mutants exhibiting novel transcriptional phenotypes. Genes Dev.
4:1875–1885.
26. Watanabe, T. 1997. HTLV-1-associated diseases. Int. J. Hematol. 66:257–
278.
27. Weng, J. J., and B. Y. Yung. 2005. Nucleophosmin/B23 regulates PCNA
promoter through YY1. Biochem. Biophys. Res. Commun. 335:826–831.
28. Winter, H. Y., T. Dayaram, and S. J. Marriott. 2007. Activation of the human
T-cell leukemia virus type 1 long terminal repeat by the ternary complex
factor Elk-1. J. Virol. 81:13075–13081.
29. Winter, H. Y., and S. J. Marriott. 2007. Human T-cell leukemia virus type 1
Tax enhances serum response factor DNA binding and alters site selection.
J. Virol. 81:6089–6098.
30. Yoshida, M., I. Miyoshi, and Y. Hinuma. 1982. Isolation and characterization
of retrovirus from cell lines of human adult T-cell leukemia and its impor-
tance in the disease. Proc. Natl. Acad. Sci. USA 79:2031–2035.
11722 EDWARDS AND MARRIOTT J. VIROL.
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.