---
id: "edwards-2014-p30-tlr3"
title: "Human T-Cell Leukemia/Lymphoma Virus Type 1 p30, but Not p12/p8, Counteracts Toll-Like Receptor 3 (TLR3) and TLR4 Signaling in Human Monocytes and Dendritic Cells"
authors:
  - "Claudio Fenizia"
  - "Martina Fiocchi"
  - "Kathryn Jones"
  - "Robyn Washington Parks"
  - "Michele Ceribelli"
  - "Sebastien A. Chevalier"
  - "Dustin Edwards"
  - "Francis Ruscetti"
  - "Cynthia A. Pise-Masison"
  - "Genoveffa Franchini"
venue: "Journal of Virology"
year: 2014
date: "2014-01"
doi: "10.1128/jvi.01788-13"
url: "/research/publications/10-1128-jvi-01788-13/"
pdf: "/research/publications/10-1128-jvi-01788-13/dustin-edwards-10-1128-jvi-01788-13.pdf"
pmc: "https://pmc.ncbi.nlm.nih.gov/articles/PMC3911690/"
openAccess: true
citedBy: 33
citedBySource: "OpenAlex, read 2026-09-12"
---
# Human T-Cell Leukemia/Lymphoma Virus Type 1 p30, but Not p12/p8, Counteracts Toll-Like Receptor 3 (TLR3) and TLR4 Signaling in Human Monocytes and Dendritic Cells

HTLV-1 p30 suppresses the interferon response in monocytes and dendritic cells; p12 and p8 do not.

## Abstract

The human T-cell leukemia/lymphoma virus type 1 (HTLV-1) p30 protein, essential for virus infectivity in vivo, is required for efficient infection of human dendritic cells (DCs) but not B and T cells in vitro. We used a human monocytic cell line, THP-1, and dendritic cells to study the mechanism of p30 and p12/p8 requirements in these cell types. p30 inhibited the expression of interferon (IFN)-responsive genes (ISG) following stimulation by lipopolysaccharide (LPS) of Toll-like receptor 4 (TLR4) and by poly(I·C) of TLR3 but not of TLR7/8 with imiquimod. Results with THP-1 mirrored those for ex vivo human primary monocytes and monocyte-derived dendritic cells (Mo-mDC). The effect of p30 on TLR signaling was also demonstrated by ablating its expression within a molecular clone of HTLV-1. HTLV-1 infection of monocytes inhibited TLR3- and TLR4-induced ISG expression by 50 to 90% depending on the genes, whereas the isogenic clone p30 knockout virus was less effective at inhibiting TLR3 and TRL4 signaling and displayed lower infectivity. Viral expression and inhibition of ISG transcription was, however, rescued by restoration of p30 expression. A chromatin immunoprecipitation assay demonstrated that p30 inhibits initiation and elongation of PU.1-dependent transcription of IFN-α1, IFN-β, and TLR4 genes upon TLR stimulation. In contrast, experiments conducted with p12/p8 did not demonstrate an effect on ISG expression. These results provide a mechanistic explanation of the requirement of p30 for HTLV-1 infectivity in vivo, suggest that dampening interferon responses in monocytes and DCs is specific for p30, and represent an essential early step for permissive HTLV-1 infection and persistence.

## Full text

Machine-extracted from the PDF linked above. It carries the artifacts that come with reading a typeset two-column page: running heads, figure captions in the flow of the prose, and words broken across line ends. The abstract above is the registry's deposit and is the authoritative text.

Human T-Cell Leukemia/Lymphoma Virus Type 1 p30, but Not p12/
p8, Counteracts Toll-Like Receptor 3 (TLR3) and TLR4 Signaling in
Human Monocytes and Dendritic Cells
Claudio Fenizia,a Martina Fiocchi,b Kathryn Jones,c Robyn Washington Parks,a Michele Ceribelli,f Sebastien A. Chevalier,d
Dustin Edwards,a Francis Ruscetti,e Cynthia A. Pise-Masison,a Genoveffa Franchinia
‹Animal Models and Retroviral Vaccines Section, National Cancer Institute, NIH, Bethesda, Maryland, USAa; Laboratorio Di Immunologia, LITA Vialba, UNIMI, Milan, Italyb;
Basic Research Program, SAIC-Frederick, Inc., National Cancer Institute, NIH, Frederick, Maryland, USAc; Laboratory of Cellular Oncology, Center for Cancer Research,
National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USAd; Laboratory of Experimental Immunology, CCR, NCI, Frederick, Maryland, USAe;
Metabolism Branch, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USAf
The human T-cell leukemia/lymphoma virus type 1 (HTLV-1) p30 protein, essential for virus infectivity in vivo, is required for
efficient infection of human dendritic cells (DCs) but not B and T cells in vitro. We used a human monocytic cell line, THP-1,
and dendritic cells to study the mechanism of p30 and p12/p8 requirements in these cell types. p30 inhibited the expression of
interferon (IFN)-responsive genes (ISG) following stimulation by lipopolysaccharide (LPS) of Toll-like receptor 4 (TLR4) and by
poly(I·C) of TLR3 but not of TLR7/8 with imiquimod. Results with THP-1 mirrored those for ex vivo human primary monocytes
and monocyte-derived dendritic cells (Mo-mDC). The effect of p30 on TLR signaling was also demonstrated by ablating its ex-
pression within a molecular clone of HTLV-1. HTLV-1 infection of monocytes inhibited TLR3- and TLR4-induced ISG expres-
sion by 50 to 90% depending on the genes, whereas the isogenic clone p30 knockout virus was less effective at inhibiting TLR3
and TRL4 signaling and displayed lower infectivity. Viral expression and inhibition of ISG transcription was, however, rescued
by restoration of p30 expression. A chromatin immunoprecipitation assay demonstrated that p30 inhibits initiation and elonga-
tion of PU.1-dependent transcription of IFN-1, IFN-, and TLR4 genes upon TLR stimulation. In contrast, experiments con-
ducted with p12/p8 did not demonstrate an effect on ISG expression. These results provide a mechanistic explanation of the re-
quirement of p30 for HTLV-1 infectivity in vivo, suggest that dampening interferon responses in monocytes and DCs is specific
for p30, and represent an essential early step for permissive HTLV-1 infection and persistence.
Human T-cell leukemia/lymphoma virus type-1 (HTLV-1) is
the etiologic agent of adult T-cell leukemia/lymphoma
(ATL), a malignant proliferation of CD4 T lymphocytes, and of
a neurodegenerative disease (1, 2) designated tropic spastic para-
paresis/HTLV-1-associated myelopathy (TSP/HAM). It is cur-
rently estimated that 20 million people worldwide are HTLV-1
infected, but only a small percentage of them progress to disease,
usually after long clinical latency. In fact, 3 to 5% of HTLV-1-
infected individuals develop ATL and 0.3 to 2% develop TSP/
HAM, whereas the majority remain asymptomatic (3–10). T cells
have been considered the key target cells for HTLV-1 infection, as
the virus is almost always present in the ATL cells and is found
in the T cells of TSP/HAM patients. However, whether cells other
than T cells also contribute to the pathogenesis of HTLV-1 infec-
tion remains unclear. HTLV-1 also infects monocytes/macro-
phages and dendritic cells (DCs) (11–15) that are professional
antigen-presenting cells and shape the host response to viruses, as
well as to other pathogens. DCs isolated from HTLV-1-positive
patients are defective in alpha interferon (IFN-) response upon
in vitro stimulation, and their ability to activate T cells is impaired
(16). In addition, in HTLV-1 infection, alteration in monocyte
differentiation and activation has been reported (17, 18). Al-
though the majority of HTLV-1 DNA is found in both CD4 and
CD8 T cells, up to 20% of the total virus burden is found in
monocytes (our unpublished data). In the macaque model, but
not in the rabbit model, the ablation of p30 expression (p30
knockout [p30-KO]) or of p12/p8 (p12-KO) within a biologically
active HTLV-1 molecular clone severely affects its infectivity.
When infection occurs in the case of p30-KO, it is associated with
early reversion of the virus to the wild-type genotype, and in the
case of p12-KO, neither infection nor nongenetic reversion is ob-
served. These data underscore the importance of these viral genes
(19). Furthermore, the infectivity of p30-KO and p12-KO in hu-
man primary monocyte-derived dendritic cells (Mo-mDCs) is
also severely impaired. In contrast, the lack of expression of p30 or
p12/p8 in human B cells (19) or primary human CD4 T cells (our
unpublished data) does not affect viral replication in vitro. Prior
data demonstrated that p30, by interacting with the cellular tran-
scription factor PU.1 in the monocytic cell line THP-1 (20), affects
Toll-like receptor 4 (TLR4) signaling and, by modulating the
CREB-responsive promoters, affects the expression of several
genes involved in apoptosis, cell cycle, and transcription, pointing
to p30 as a regulator of innate response to HTLV-1 (21).
PU.1, also known as Spi-1, is a transcriptional factor in the ETS
family. Its expression is cell specific, and it has been found in
macrophages, dendritic cells, B cells, and neutrophils (22, 23).
PU.1 plays a critical role in cell activation and differentiation (24).
Interestingly, PU.1 can interact with a variety of factors, including
Received 1 July 2013 Accepted 17 October 2013
Published ahead of print 23 October 2013
Address correspondence to Genoveffa Franchini, franchig@mail.nih.gov.
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/JVI.01788-13
January 2014 Volume 88 Number 1 Journal of Virology p. 393– 402 jvi.asm.org 393
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

IRF4, ICSBP/IRF8, JUN, and NF-B, and promotes transcription
of type 1 interferons (7, 14, 15, 17, 23–26). Therefore, PU.1 is
involved in the signal transduction upon activation of different
TLRs. In fact, TLR3 and TLR4 can trigger NF-B, TLR4 activates
IRF4, and TLR7, TLR8, and TLR9 activate JUN (22, 22–24, 27,
28). Type 1 IFNs then are able to stimulate the production of a
wide variety of antiviral interferon-stimulated genes (ISGs), such
as those producing myxovirus resistance GTPase protein A
(MxA); apolipoprotein B mRNA-editing, enzyme-catalytic, poly-
peptide-like 3G (APOBEC-3G or A3G); and 2=,5=-oligoadenylate
synthetase (OAS) (29–31).
The interaction of p30 and PU.1 has been demonstrated to
inhibit the transcriptional activity of PU.1, resulting in a decreased
expression of TLR4 at the cell surface and decreased secretion of
proinflammatory cytokines, such as MCP-1, tumor necrosis fac-
tor alpha (TNF-), and interleukin-8 (IL-8), and increased pro-
duction of the anti-inflammatory cytokine IL-10 (20). Type 1
IFNs are the most potent innate antiviral factors, and both DNA
and RNA viruses, as well as other pathogens, have evolved a so-
phisticated and varied strategy to counteract these innate protec-
tive responses (31).
While TLR3 and TLR4 receptors are expressed on the cell sur-
face and the TLR7/8 receptors are expressed in the endosomes
(32), they share common downstream pathways for the induction
of expression of type1 IFN-responsive genes. TLR3 and TLR7/8
are involved in detection of viruses, since they recognize single-
stranded RNA (ssRNA) and double-stranded RNA (dsRNA)
structures that can be present during the replication of retrovi-
ruses, such as HTLV-1. We hypothesized that p30 affects not only
TLR4 but also TLR3 and TLR7/8 signaling in virus-infected
monocytes and in dendritic cells, and that by affecting the overall
type 1 IFN response, p30 affects the activation and differentiation
of these cells and ultimately the host response to the virus. We also
hypothesized that p12/p8 also affects TLR7/8 significantly, since
these proteins are localized in the endoplasmic reticulum (ER)
and Golgi complex (25, 33). Indeed, the other known human-
pathogenic retrovirus, HIV, which replicates at a high level in the
host and causes, if untreated, AIDS in nearly all infected individ-
uals (34–37), has evolved several genes that are able to counteract
restriction factors. An example is the vif gene that counteracts the
ability of APOBEC-3G, an interferon-inducible gene to deaminate
the base composition of the viral RNA genome, rendering it non-
infectious (38). Thus, understanding how HTLV-1 evades the in-
nate host response and affects immune activation/inflammation is
of importance to gain more understanding of its ability to persist
and to induce autoimmune manifestations.
MATERIALS AND METHODS
Cell lines and primary human cells. The 729-6 B-cell lines infected with
the pACH wild-type (WT) virus and the p30-KO and p12-KO viral mu-
tants were maintained in RPMI 1640, 10% fetal bovine serum (FBS). In
the case of the leukemic monocyte-like THP-1 human cell line, the same
medium was supplemented with 50 M -mercaptoethanol. Primary
monocyte-derived dendritic cells (Mo-mDC) were obtained from hepa-
rinized human peripheral blood from healthy donors and were treated
with Ficoll-Paque plus (GE Healthcare, Chalfont St. Giles, United King-
dom) according to the manufacturer’s instructions, and monocytes then
were separated by elutriation, checked for purity (98% CD14 positive),
and differentiated after approximately 7 days of culture in RPMI 1640,
20% BIT (Stem Cell Technologies, Vancouver, Canada) with 50 ng/ml
interleukin-4 (IL-4; Peprotech, Rock Hill, NJ), 50 ng/ml granulocyte-
macrophage colony-stimulating fibroblast (GM-CSF) (Peprotech, Rock
Hill, NJ), and 10 ng/ml transforming growth factor beta (TGF-) (R&D
Systems, Minneapolis, MN). Mo-mDC purity was checked by phenotype
as illustrated by CD14, CD3 Cd19, CD1A, and CD11C cells.
CD4 or CD8 T lymphocytes were separated from peripheral blood
mononuclear cells (PBMCs) by positive-selection magnetic beads (Invit-
rogen, Carlsbad, CA) and cultured in RPMI 1640, 10% FBS, 250 U/ml
IL-2. Fifty ng/ml phorbol myristyl acetate (PMA) (Sigma, St. Louis, MO),
20 ng/ml lipopolysaccharide (LPS) (List Biological Laboratories Inc.,
Campbell, CA), 10 g/ml poly(I·C) HMW (InvivoGen, San Diego, CA),
and imiquimod (InvivoGen, San Diego, CA) were utilized for stimulation
of TLRs.
Virus infection, transfection, detection of virus productions, and
protein expression. The HTLV-1-WT or the HTLV-1-p30-KO or HTLV-
1-p12-KO producer 729-6 B-cell line was used to harvest HTLV-1 virions
(19). The supernatants of such cell lines were collected and ultracentri-
fuged at 23,000 rpm for 150 min to isolate the virions, which then were
resuspended in phosphate-buffered saline (PBS). In order to enhance the
infectivity, THP-1 cells were spin infected at 3,000 rpm for 1 h in the
presence of 8 g/ml Polybrene (Sigma, St. Louis, MO). The production of
HTLV-1 in the supernatant of the infected cell cultures was assessed by
measuring the amount of MA (p19 Gag) protein by enzyme-linked im-
munosorbent assay (ELISA) according to the manufacturer’s instructions
(Zeptometrix, Buffalo, NY). HTLV-1 proviral load was measured in the
various cell lines as previously described (19). Briefly, real-time PCR was
performed on genomic DNA extracted with the DNeasy tissue kit accord-
ing to the manufacturer’s protocol. The TaqMan probe and PCR primers
for the real-time PCR were designed within the integrase gene of HTLV-1.
The sequence of the TaqMan probe was 5=-TGTCCACCTGCCATTAAG
CCCGA-3=, and the DNA primers sequences were the following: forward,
5=-GCAGAGGAGGAAATTACCCAGTAC-3=; reverse, 5=-CAATTTTAC
CCAGGCATTTAATGT-3=. The normalized value of the HTLV-1 provi-
ral DNA load was calculated as HTLV-1 DNA copy number/albumin gene
copy number and expressed as the number of HTLV-1 proviral DNA
copies per 106 cells. In order to determine the surface expansion of specific
markers on the THP-1 cell lines, phenotype was assessed by flow cytom-
etry. Cells were incubated with the proper antibodies for 15 min at room
temperature and then fixed in 1% paraformaldehyde, run on an LSR II
(BD Bioscience, San Jose, CA), and analyzed with FlowJo (Tree Star Inc.,
Ashland, OR). In the case of intracellular cytokine staining, 1 g/ml of the
protein transport inhibitor brefeldin A (BD, San Jose, CA) was added to
the culture 6 h before the analysis. The antibodies used were CD14 (Bio-
Legend, San Diego, CA); CD80, CD83, CD86, TNF-, and CCR7 (BD
Bioscience, San Jose, CA); IL-12 (eBioscience, San Diego, CA); and TLR4.
In order to efficiently express the p30 protein, THP-1 cells were trans-
duced with lentiviral vectors based on Naldini’s system. In order to pro-
duce lentiviruses, pSDM101 or pSDM101-p30, pDM2.G, and pSAX were
transduced into 293T cells with LipoD293 (Signagen, Rockville, MD). The
supernatant was harvested, filtered (pore size, 0.22 m), and used during
spin infection as described above. The efficiency of transduction was
checked by flow cytometry and ranged between 80 and 95%.
Quantification by real-time PCR of ISGs. For real-time PCR, total
RNA was extracted from cells and retrotranscribed (Qiagen, Valencia,
CA). Reactions were performed using a SYBR fast quantitative PCR
(qPCR) mix (KapaBiosystems, Woburn, MA). The primer sequences
were the following (5= to 3=): 18s forward, GCCCGAAGCGTTTACTT
TGA; reverse, TCCATTATTCCTAGCTGCGGTATC; MxA forward, AG
GAGTTGCCCTTCCCAGA; reverse, TCGTTCACAAGTTTCTTCAGTT
TCA; APOBEC3G forward, CCGTCTGGGTGTGCTACGAA; reverse,
GCTTCCTCCACTTGCTGAACCA; OAS forward, CAGTCCTGGTGAG
TTTGCAGT; reverse, GCCAGTGCTTTATCAAGAGGAT. Results are
expressed as delta delta threshold cycles ( CT) and are presented as rat
ios between the target gene and the 18S housekeeping mRNA.
Immunoblot analysis. Protein samples (20 g each) were separated
by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (4 to 12%)
Fenizia et al.
394 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

in morpholineethanesulfonic acid (MES) SDS running buffer (Invitro-
gen, Carlsbad, CA) and transferred to Immobilon P membranes (Milli-
pore, Billerica, MA). The membranes were blocked with PBS, 0.1%
Tween, and 4% nonfat dried milk and then probed with primary antibody
directed to the hemagglutinin (HA) tag or tubulin, and the appropriate
horseradish peroxidase (HRP)-conjugated secondary antibody was used
for detection. SuperSignal West Pico chemiluminescent substrate (Pierce,
Rockford, IL) was used as the HRP substrate.
ChIP assay. Chromatin immunoprecipitations (ChIPs) were per-
formed as follows. Briefly, for each chromatin preparation, 5 107 cells
were resuspended in 50 ml of medium without FBS and cross-linked in
1% formaldehyde for 10 min at room temperature. Cross-linking was
quenched by 125 mM glycine for 5 min at room temperature. Cross-
linked cells were then washed with ice-cold PBS and resuspended in ice-
cold radioimmunoprecipitation assay (RIPA) buffer (10 mM Tris-HCl
pH 8, 140 mM NaCl, 1 mM EDTA pH 8, 0.5 mM EGTA, 1% Triton X-100,
0.3% SDS, and 0.1% sodium deoxycholate) to a final concentration of 5
106 cell/ml. DNA was sheared with a Misonix XL sonicator by performing
12 30-s sonication cycles at power setting 5. For each single immunopre-
cipitation, 5 106 chromatin cell equivalents in the 200- to 500-bp range
were immunoprecipitated with 5 g of the following antibodies: anti-HA,
anti-RNA-polymerase II (Pol II), anti-RNA-polymerase II phosphoser-
ine5 (Pol II-S5) (Abcam), anti-RNA-polymerase II phosphoserine2 (Pol
II-S2) (Covance), and anti-PU.1 (Cell Signaling). Parallel ChIPs were run
with a Flag M2 antibody as the negative control (Sigma). Immunoprecipi-
tation-enriched DNAs were used to perform real-time PCR. Oligonucle-
otides were designed to specifically target and quantify the promoter
region of IFN-1 (forward, 5=-GGAACAAGATGGGGAAGACA-3=; re-
verse, 5=-GCAGATACTTCTGGGCTTGC-3=), IFN-2 (forward, 5=-AAG
GCTCTGGGGTAAAAGA-3=; reverse, 5=-GACCTTGCTTTGTGCCTAG
C-3=), IFN- (forward, 5=-AGGACCATCTCATATAAATAGGCCATAC
CC-3=; reverse, 5=-ACTGAAAATTGCTGCTTCTTTGTAGGAATC-3=),
TLR4 (forward, 5=-GCCAACTAGCTTCCTCTTGCTG-3=; reverse, 5=-C
ACCGTCTGACCGAGCAGTT-3=), and UbiquitinB (forward, 5=-GAAG
GAAGAGAAGCGCATAGAGGAGAA-3=; reverse, 5=-CTCATAGCCGT
AAGAAAGGCTCCTAAA-3=). The CT method was used to calculate
ChIP qPCR enrichments.
Statistical analysis. Analysis of variance (ANOVA) tests with Bonfer-
roni posttests were performed with the informatics support of Graphpad
Prism 5.
RESULTS
HTLV-1 p30 decreases TLR4 expression. HTLV-1-p30 protein
interacts in the nucleus with PU.1 and is able to repress TLR4
expression on the cell surface (20). Thus, at first we verified that in
FIG 1 p30 affects TLR4 signaling in THP-1 cells. (A) Flow-cytometric analysis of THP-1 cells transduced with p30 (black line) or control (dotted line) lentivirus.
TLR4 expression on the cell surface was assessed following 3 h of stimulation with PMA (PMA) or after no stimulation (PMA). The CD14 surface marker was
used as a control (right). (B) Real-time PCR was performed on the TLR4 mRNA in THP-1 cells transduced with p30 or the control with or without PMA
stimulation. The results are shown as a percentage of relative expression of the PMA-stimulated mock-transduced cell. The statistically significant differences are
marked with an asterisk, which indicates a P value of less than 0.0001. Statistics were determined from three independent experiments (n 3). (C) Flow-
cytometric analysis of THP-1 cells transduced with p30 (black line) or mock transduced (dotted line). Twelve hours following LPS stimulation, cells were
collected and analyzed for intracellular production of IL-12 and TNF-.
p30 Inhibits TLR Signaling in Monocyte/Dendritic Cells
January 2014 Volume 88 Number 1 jvi.asm.org 395
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

our experimental conditions, p30 affected TLR4 expression. We
transduced THP-1 cells with control lentivirus or lentivirus express-
ing the p30 cDNA (Fig. 1). We confirmed the appropriate nuclear
localization of p30 in this cell type (21, 39, 40, and data not shown).
TLR4 expression on the cell surface of transduced cells was analyzed
by flow cytometry with or without stimulation with phorbol myristyl
acetate (PMA). While untreated, p30- or control-transduced THP-1
cells showed similar levels of TLR4 expression on the cell surface;
when treated with PMA, an upregulation of TLR4 expression was
observed in the control but not in the p30-transduced THP-1 cells
(Fig. 1A, left and middle). As previously published (20), the CD14
surface marker expression, used as a control, was not affected by p30
(Fig. 1A, right). The mechanism underlying the effect of p30 was
transcriptional, as confirmed by quantitative real-time PCR per-
formed on the TLR4 mRNA (Fig. 1B).
These data are consistent with the findings of Datta and col-
leagues (20), which demonstrated that p30 decreases the release of
proinflammatory cytokines, such as TNF-, IL-8, and MCP1,
upon stimulation with the TLR4-specific agonist lipopolysaccha-
ride (LPS) by decreasing the expression of TLR4 itself. Similarly,
we transduced THP-1 cells with p30 lentivirus or with the control
lentivirus, and after 12 h of LPS stimulation, cells were collected
and analyzed by flow cytometry for intracellular production of
IL-12 and TNF- (Fig. 1C). In both cases, the presence of p30
decreased the expression of such cytokines upon LPS stimulation
compared to that with the control.
p30 decreases TLR3 induction of ISG expression in THP-1
cells but not that of TLR7/8. We next studied the effect of p30 on
TLR3 and TLR7/8 because of their relevance in virus immune
surveillance, since they recognize the dsRNA or ssRNA, respec-
tively, which are intermediates of HTLV-1 infection. THP-1 cells
were p30 or mock transduced, and then they were stimulated with
a specific agonist of TLR3, such as poly(I·C), or a specific agonist
of TLR7/8, such as imiquimod (Fig. 2). LPS stimulation on TLR4
was used as a control. The magnitude of the stimulation was ap-
proximately 4 times in the case of poly(I·C), between 10 and 15
times in the case of LPS, and approximately 3 times for imi-
quimod. We analyzed by real-time PCR the level of mRNA expres-
sion of ISGs and selected the most common ISGs to measure the
overall type I interferon response, such as MxA, APOBEC-3G
(also called A3G), and OAS. The results are shown in terms of
percentage of relative expression of these ISGs in the presence of
p30 expression versus the mock-transduced control following 6 h
of TLR3 and TLR4 stimulation. Following the poly(I·C) stimula-
tion, MxA and OAS expression was significantly inhibited by p30,
and this difference also was significant when the expression of all
genes together was analyzed (P 0.01) (Fig. 2A). A similar effect
was observed following LPS stimulation (Fig. 2B), as expected.
Surprisingly, no difference was found following stimulation with
imiquimod (Fig. 2C). The lack of p30-mediated inhibition of imi-
quimod was not due to differences in the expression of p30, as
demonstrated in Fig. 2D. Similar experiments were performed
using cDNA encoding p12/p8, since the presence of these pro-
teins is essential for infectivity of monocytes as well (19). In
contrast to p30, p12/p8 did not have a significant effect on the
FIG 2 p30 decreases TRL3 and TRL4 but not TLR7/8 signaling. (A to C) Real-time quantitative PCR analysis of type 1 ISGs. THP-1 cells were transduced with
p30 or control lentivirus, kept in culture for 72 h, and stimulated for 6 h with poly(I·C) (A), LPS (B), or imiquimod (C). The results are presented as the percentage
of inhibition of the expression of the MxA, A3G, and OAS mRNAs versus the mock-transfected control. The statistically significant differences are marked with
one or two asterisks, which indicate a P value of less than 0.01 or 0.0001, respectively. Statistics were determined from four independent experiments. (D)
Immunoblot analysis of tubulin and p30 expression of the experiments presented in panels A to C.
Fenizia et al.
396 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

ISGs upon specific TLR3, TLR4, and TLR7/8 stimulation (data
not shown).
p30 decreases TLR3 and TLR4 induction of interferon-stim-
ulated gene expression in Mo-mDCs. To validate the results ob-
tained in the human tumor THP-1 cell line with p30, we per-
formed the same experiments on ex vivo primary human
monocytes and in vitro primary human Mo-mDCs. PBMCs were
isolated by Ficoll gradient from a LeukoPak, and primary mono-
cytes were separated by adherence for 6 h. Cells were transduced
with p30 or were mock transduced, and then they were stimulated
with poly(I·C), LPS, or imiquimod. The expression of the indi-
cated ISGs was significantly inhibited by the presence of p30 upon
stimulation with poly(I·C) (Fig. 3A) or LPS (Fig. 3B) but not with
imiquimod (Fig. 3C), consistent with our observations in THP-1
cells. In the case of Mo-mDCs, after isolation of PBMCs by Ficoll
gradient, primary monocytes were separated by elutriation to
keep them inactivated and left undisturbed. After 7 days of differ-
entiation with IL-4, GM-CSF, and TGF- (12, 19), the cell phe-
notype was verified and cells were transduced with p30 or were
mock transduced, and then they were stimulated with poly(I·C) or
LPS. Expression of p30 inhibited significantly the mRNA expres-
sion of all ISGs studied following stimulation with poly(I·C) and
LPS, as demonstrated in Fig. 3D and E, respectively. The level of
expression of p30 protein was comparable in all of the conditions
tested (data not shown). These data demonstrate that in ex vivo
primary monocytes and in vitro primary human dendritic cells,
p30 expression inhibits TLR3 and TLR4 signaling and corrobo-
rates the THP-1 cell model.
Ablation of p30 from an HTLV-1 molecular clone results in
decreased inhibition of TLR3- and TLR4-induced ISG expres-
sion in THP-1 cells that is partly restored by p30 overexpression.
To test the contribution of p30 without using overexpression sys-
tems, we infected THP-1 cells with the WT clone or the p30-KO
HTLV-1 molecular clones (19) and tested the response of the cells
to TLR3 and TLR4 stimulation. p30-KO HTLV-1, in which the
expression of p30 was ablated, produced a lower level of virus, as
measured by the p19 Gag levels released at the peak into the su-
pernatant compared to that of the WT (Fig. 4A) (19). Accordingly,
a lower level of viral DNA was found by quantitative real-time
PCR in the cells exposed to p30-KO than to the WT, with approx-
imately 1 copy per cell versus 4 copies per cell, respectively (data
not shown). However, even under conditions of low levels of virus
production, the infected cells continued to express high levels of
the CD80/83 and CD86 immune activation markers and the
CCR7 homing marker (Fig. 4B). In addition, the replication rate
of infected THP-1 cells was approximately doubled compared to
that of uninfected cells (15 versus 30 h). At week 19, when viral
expression was equivalently low in both cell cultures (Fig. 4A), we
stimulated the cells for 6 h with poly(I·C) and LPS for TLR3 and
TLR4, respectively. After stimulation, RNA was extracted and
tested for ISG expression. The results are shown as a percentage of
relative expression of the ISGs in uninfected THP-1 cells versus
the WT- or p30-KO-infected THP-1 cells. The response to TLR
stimulation was significantly inhibited by infection with the WT
virus but much less so in cells infected with the p30-KO virus (Fig.
4C and D).
FIG 3 p30 decreases TLR3 and TLR4 signaling in primary human monocytes and primary human monocyte-derived dendritic cells. Real-time PCR quantitative
analysis of the expression of ISGs on primary monocytes and Mo-mDC was performed. Primary monocytes were transduced with p30 or control lentivirus.
Seventy-two h later, the cells were stimulated with poly(I·C) (A), LPS (B), or imiquimod (C). The results are shown as the percentage of relative expression of ISG
mRNAs, such as MxA, A3G, and OAS, following 6 h of TLR stimulation. Primary elutriated monocytes were differentiated into Mo-mDC and transduced with
p30 or control lentivirus. Seventy-two h later, the cells were stimulated with poly(I·C) (D) or LPS (E). Immunoblot analysis of tubulin and p30 was performed,
and no differences were found in p30 expression (data not shown). The statistically significant differences are marked with one or two asterisks, which indicate
a P value of less than 0.01 or 0.0001, respectively. Statistics were determined from two and four independent donors for primary monocytes and Mo-mDC,
respectively.
p30 Inhibits TLR Signaling in Monocyte/Dendritic Cells
January 2014 Volume 88 Number 1 jvi.asm.org 397
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

p30-KO HTLV-1 virus production and ISG inhibition is res-
cued by overexpression of p30. We next investigated whether we
could rescue viral expression and IFN responses by overexpressing
p30 in cells obtained at week 10 postinfection (Fig. 4A). WT- or
p30-KO-infected THP-1 cells were transduced with p30 or mock
lentivirus. Untransduced cells were used as a control. After 2 days,
the supernatants were collected and p19 Gag was analyzed by
ELISA. Interestingly, p30 expression restored virus production in
cells infected with the p30-KO virus (Fig. 5A). Consistent with p30
reducing ISG expression, reverse transcription-PCR analysis of
cellular mRNA demonstrated that expression of MxA and A3G
genes was higher in cells infected with p30-KO virus than in cells
infected with WT virus (Fig. 5B). Transduction of p30-KO-in-
fected cells with lentivirus expressing p30 only partially rescued
MxA and A3G mRNA expression, suggesting that another viral
gene participates in inhibition of ISG expression (Fig. 5B). Pro-
teins were extracted and tested by Western blotting to demon-
strate comparable expression of p30 and green fluorescent protein
(GFP) (Fig. 5C).
ChIP. To explore the mechanism by which p30 affects TLR3/4
function, we performed a chromatin immunoprecipitation assay.
THP-1 cells were p30 or mock transduced with lentivirus. Cells
were stimulated for 1 h with the specific agonists poly(I·C) and
LPS as a control and then cross-linked. The pulldowns were per-
formed with antibodies against PU.1, p30-HA, and total RNA Pol
II, as well as with antibodies specific for the phosphorylated form
of RNA Pol II, CTD-Ser5 and RNA Pol II CTD-Ser2, which iden-
tify the initiating and the elongating form of active RNA Pol II,
FIG 4 Chronically infected monocyte responses to TLR signaling. (A) THP-1 cells were infected with WT (dashed line) or p30-KO HTLV-1 (solid line) virus.
Productive infection was monitored by p19 Gag ELISA in the cell supernatant. Uninfected controls were negative for p19 Gag and are not represented in the
graph. (B) At week 18 postinfection, the phenotypes of the THP-1 cells infected with WT or p30-KO HTLV-1 or left uninfected were analyzed for activation
markers, such as HLA-DR, CD80/83, CD86, and the CCR7 homing marker. (C and D) ISGs were measured at week 10 postinfection by real-time PCR on the RNA
from the WT or p30-KO HTLV-1 chronically infected or uninfected THP-1 cells following stimulation with poly(I·C) (C) or LPS (D) for 6 h. The statistically
significant differences are marked with one or two asterisks, which indicate a P value of less than 0.05 or 0.01, respectively. Statistics were determined from three
independent experiments (n 3).
Fenizia et al.
398 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

respectively. Real-time PCR was performed on the ChIP-enriched
DNA to quantify the amount of PU.1 containing transcriptional
complexes bound to the promoters of the IFN-1, IFN-, TLR4,
and UbiquitinB genes. We observed that upon TLR4 stimulation
with LPS, lentiviral expression of p30 decreased the amount of
PU.1 recruited to the IFN-1 (Fig. 6A), IFN- (Fig. 6D), and
TLR4 promoters (Fig. 6G). Moreover, the reduced PU.1 binding
was paralleled by similar decreases of both initiating and elongat-
ing RNA Pol II, as assessed by Pol II-S5 and Pol II-S2 ChIP (Fig.
6B, C, E, F, H, and I). Similarly, after poly(I·C) stimulation of
TRL3, the presence of p30 resulted in decreased binding of PU.1,
Pol II-S5, and Pol II-S2 to the promoters of IFN-, IFN-, and
TLR4 genes (Fig. 6A to I). The real-time PCR performed on the
UbiquitinB promoter, used as a control, showed no significant
differences, as expected (data not shown). All of these data are
consistent with the reduced expression of IFN-responsive genes
following TLR3 and TLR4 stimulation being mediated by p30 at
the transcriptional level, as was previously suggested for TLR4
(20).
DISCUSSION
Interferons (IFNs) are key molecules that mediate antiviral innate
immune responses and are potent regulators of adaptive immune
responses, since they affect immune cell activation, cell growth,
and apoptosis. Type I IFNs ( and ) are produced mainly by
dendritic cells, macrophages, and fibroblasts following activation
of the pattern recognition receptor (PPR) by pathogens, including
viruses (41). Once the IFN response is triggered, the expression of
more than 300 genes (ISGs) is upregulated. These genes encode
proteins that have antiviral and immunoregulatory activity and
are able in some cases to suppress viral replication and clear virus
(42). Among them, MxA, OAS, and A3G exert a particularly im-
portant role in the immune intracellular response and are consid-
ered excellent markers for IFN action. Viruses, and often patho-
gens, have evolved a wide variety of strategies to counteract and
escape the IFN system by a mechanism called inverse interference
(41). The molecular mechanisms involved span from the shut-
down of the entire cell metabolism to specifically targeting IFN at
different levels, such as to inhibit the type-1 IFN production itself,
to inactivate secreted IFN molecules, and to block the signaling
pathways or the functionality of IFN-induced protein. A variety of
viruses, such as influenza virus (43), Sendai virus (44), measles
virus (45), Ebola virus (46), herpes simplex virus (41), human
papillomavirus (41), adenovirus (41), and hepatitis C virus (47),
have evolved a way to interfere with specific components of the
IFN induction pathway, mainly by blocking the IFN regulatory
factors (IRFs). On the other hand, Dengue virus (41), human
papillomavirus (26), hepatitis C virus (47), and paramixoviruses
(41) target the JAK-STAT pathway. HIV interferes with IFN-in-
duced PKR and A3G through Tat and Vif, respectively (48, 49).
HTLV-1 has evolved its own strategy to counteract the IFN
system. Although the mechanism is not fully understood,
Hishizawa et al. have shown that dendritic cells isolated from
FIG 5 p30 rescues viral production and IFN responses in THP-1 cell infected with the p30-KO mutant virus. (A) Level of p19 Gag in THP-1 cells chronically
infected with WT or p30-KO HTLV-1 virus transduced with the lentivirus expressing p30 or the control lentivirus. (B) Real-time PCR for the MxA and A3G ISGs
from the RNAs of the infected/transduced cells. (C) Western blot analysis for tubulin, p30, or GFP on transduced cells. The statistically significant differences are
marked with one or two asterisks, which indicate a P value of less than 0.05 or 0.005, respectively. Statistics were determined from three independent experiments
(n 3).
p30 Inhibits TLR Signaling in Monocyte/Dendritic Cells
January 2014 Volume 88 Number 1 jvi.asm.org 399
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

HTLV-1-infected individuals have an impaired ability to secrete
type 1 IFN (16). In addition, it has been reported that the cellular
protein SOCS, which inhibits STAT1 phosphorylation, inhibits
intracellular signal transduction downstream of the IFN receptor,
IFNAR1/2, in both ex vivo CD4 cells from HTLV-1-infected in-
dividuals and in vitro in HTLV-1-infected cells (50–52). More-
over, in HTLV-1-infected cells in vitro, the level of phosphoryla-
tion of Tyk2 and STAT2, two key molecules in the activation
cascade of the IFN pathway, is decreased (53). Tax also prevents
the binding of CBP/p300 with STAT2 in a competitive manner
(54).
Despite all of the above-mentioned anti-IFN mechanisms
evolved by HTLV-1, type 1 IFN maintains a potent antiviral func-
tion and is used in the clinic as anti-HTLV-1 therapy (42) for ATL.
While IFN- treatment alone results in a modest and transient,
although appreciable, beneficial effect on ATL patients, when
combined with zidovudin (AZT) and arsenic trioxide it causes
long-lasting remission (42). The mechanisms underlying this
therapeutic effect remain unclear. In fact, while some groups dem-
onstrated in vitro that the treatment with IFN- decreases
HTLV-1 expression, Kannagi’s group showed that the level of p19
Gag released in the supernatant is decreased, but not the expres-
sion of other viral genes (55). However, the addition of AZT de-
creases viral transcription and p19 Gag and Tax production, leav-
ing the p53-dependent apoptotic pathways unaffected and
restoring the PKR antiviral activity (55).
Here, we demonstrate that HTLV-1 has evolved additional
mechanisms to counteract the IFN system through the interaction
of the viral regulatory protein p30 and the myeloid transcription
factor PU.1. Because p30 regulates the expression of other viral
RNAs, it is still debatable whether p30 acts directly or if other viral
proteins are involved in decreasing ISGs. However, the ChIP assay
FIG 6 p30 displaces PU.1 from the transcription and elongation complex. ChIP assay was performed on THP-1 cells transduced with p30 lentivirus (white bars)
or mock transduced (black bars). Cells were stimulated for 1 h with LPS or poly(I·C) (I·C) before the ChIP assay or were left unstimulated. Depicted here is the
relative amount of DNA precipitated with the different antibodies normalized to the amount found in the input of the promoters for IFN-1, IFN-, and TLR4
genes. The immunoprecipitations were performed with anti-HA and detected HA-tagged p30, anti-PU.1, anti-PolIItot, anti-PolIIS5, and anti-PolIIS2. The data
are expressed in terms of fold change (the unstimulated result is 1) and represent the amount of promoter DNA for the various genes immunoprecipitated in cells
stimulated in the presence or absence of p30. Statistically significant differences are marked with one or two asterisks, which indicate a P value of less than 0.01
or 0.0001, respectively. Statistics were determined from two independent experiments (n 2).
Fenizia et al.
400 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

we performed and the rescued inhibition of the ISGs upon p30
overexpression suggest a direct interaction between p30 and PU.1.
This is consistent with the observations reported by Datta and
colleagues (20). To address the role of other viral proteins, detailed
analysis of the viral expression pattern in the p30-KO mutant-
versus WT-infected cells needs to be done. We are currently
investigating the expression level of viral transcripts and the dif-
ferential expression of these in monocytes versus CD4 T lym-
phocytes. Indeed, we found that after the initial peak of p19 Gag in
the supernatant around day 10, virus production drops to a low
level of expression in THP-1 (Fig. 4A). Preliminary data, not in-
cluded in this paper, show that in THP-1 cells the total mRNA
level of hbz is higher than that of tax/rex message during chronic
infection. These findings suggest that in monocytes the regulation
of viral transcription follows a different pattern. The effect of p30
is pivotal to allow infectivity and persistence, as demonstrated by
in vivo experiments in macaques (19). Our data demonstrate that
in the presence of p30, the interferon response is abrogated during
viral replication. Thus, strategies aimed at silencing the expression
of p30 with siRNA in conjunction with other approaches may
further curtail viral replication and possibly contribute to the
eradication of infected cells through innate IFN-mediated im-
mune responses.
ACKNOWLEDGMENTS
We thank Teresa Habina for editorial assistance, Louis Staudt for support
of the work of Michele Ceribelli, Katherine McKinnon for assistance with
the flow cytometer, and Thorsten Demberg for helpful discussions and
PCR support.
REFERENCES
1. Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC.
1980. Detection and isolation of type C retrovirus particles from fresh and
cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc.
Natl. Acad. Sci. U. S. A. 77:7415–7419. http://dx.doi.org/10.1073/pnas.77
.12.7415.
2. Poiesz BJ, Ruscetti FW, Reitz MS, Kalyanaraman VS, Gallo RC. 1981.
Isolation of a new type C retrovirus (HTLV) in primary uncultured cells of
a patient with Sezary T-cell leukaemia. Nature 294:268 –271. http://dx.doi
.org/10.1038/294268a0.
3. Edwards D, Fenizia C, Gold H, de Castro-Amarante MF, Buchmann C,
Pise-Masison CA, Franchini G. 2011. Orf-I and orf-II-encoded proteins
in HTLV-1 infection and persistence. Viruses 3:861– 885. http://dx.doi
.org/10.3390/v3060861.
4. Hinuma Y, Nagata K, Hanaoka M, Nakai M, Matsumoto T, Kinoshita
KI, Shirakawa S, Miyoshi I. 1981. Adult T-cell leukemia: antigen in an
ATL cell line and detection of antibodies to the antigen in human sera.
Proc. Natl. Acad. Sci. U. S. A. 78:6476 – 6480. http://dx.doi.org/10.1073
/pnas.78.10.6476.
5. Kaplan JE, Osame M, Kubota H, Igata A, Nishitani H, Maeda Y,
Khabbaz RF, Janssen RS. 1990. The risk of development of HTLV-I-
associated myelopathy/tropical spastic paraparesis among persons in-
fected with HTLV-I. J. Acquir. Immune. Defic. Syndr. 3:1096 –1101.
6. Kondo T, Kono H, Nonaka H, Miyamoto N, Yoshida R, Bando F, Inoue
H, Miyoshi I, Hinuma Y, Hanaoka M. 1987. Risk of adult T-cell leukae-
mia/lymphoma in HTLV-I carriers. Lancet ii:159.
7. Maloney EM, Cleghorn FR, Morgan OS, Rodgers-Johnson P, Cranston B,
Jack N, Blattner WA, Bartholomew C, Manns A. 1998. Incidence of HTLV-
I-associated myelopathy/tropical spastic paraparesis (HAM/TSP) in Jamaica
and Trinidad. J. Acquir. Immune. Defic. Syndr. Hum. Retrovirol. 17:167–
170. http://dx.doi.org/10.1097/00042560-199802010-00011.
8. Murphy EL, Hanchard B, Figueroa JP, Gibbs WN, Lofters WS, Camp-
bell M, Goedert JJ, Blattner WA. 1989. Modeling the risk of adult T-cell
leukemia/lymphoma in persons infected with human T-lymphotropic vi-
rus type I. Int. J. Cancer 43:250 –253. http://dx.doi.org/10.1002/ijc
.2910430214.
9. Seiki M, Hattori S, Kirayama Y, Yoshida M. 1983. Human T-cell leu-
kemia/lymphotropic virus: complete nucleotide sequence of the provirus
genome integrated in leukemia cell DNA. Proc. Natl. Acad. Sci. U. S. A.
80:3618 –3622. http://dx.doi.org/10.1073/pnas.80.12.3618.
10. Yamaguchi K, Watanabe T. 2002. Human T lymphotropic virus type-I
and adult T-cell leukemia in Japan. Int. J. Hematol. 76(Suppl 2):240 –245.
http://dx.doi.org/10.1007/BF03165123.
11. de Revel T, Mabondzo A, Gras G, Delord B, Roques P, Boussin F,
Neveux Y, Bahuau M, Fleury HJ, Dormont D. 1993. In vitro infection of
human macrophages with human T-cell leukemia virus type 1. Blood
81:1598 –1606.
12. Jones KS, Petrow-Sadowski C, Huang YK, Bertolette DC, Ruscetti FW.
2008. Cell-free HTLV-1 infects dendritic cells leading to transmission and
transformation of CD4() T cells. Nat. Med. 14:429 – 436. http://dx.doi
.org/10.1038/nm1745.
13. Koralnik I, Lemp JF, Jr, Gallo RC, Franchini G. 1992. In vitro infection
of human macrophages by human T-cell leukemia/lymphotropic virus
type I (HTLV-I). AIDS Res. Hum. Retrovir. 8:1845–1849. http://dx.doi
.org/10.1089/aid.1992.8.1845.
14. Koyanagi Y, Itoyama Y, Nakamura N, Takamatsu K, Kira J, Iwamasa T,
Goto I, Yamamoto N. 1993. In vivo infection of human T-cell leukemia
virus type I in non-T cells. Virology 196:25–33. http://dx.doi.org/10.1006
/viro.1993.1451.
15. Macatonia SE, Cruickshank JK, Rudge P, Knight SC. 1992. Dendritic
cells from patients with tropical spastic paraparesis are infected with
HTLV-1 and stimulate autologous lymphocyte proliferation. AIDS Res.
Hum. Retrovir. 8:1699 –1706. http://dx.doi.org/10.1089/aid.1992.8.1699.
16. Hishizawa M, Imada K, Kitawaki T, Ueda M, Kadowaki N, Uchiyama
T. 2004. Depletion and impaired interferon-alpha-producing capacity of
blood plasmacytoid dendritic cells in human T-cell leukaemia virus type
I-infected individuals. Br. J. Haematol. 125:568 –575. http://dx.doi.org/10
.1111/j.1365-2141.2004.04956.x.
17. Makino M, Wakamatsu S, Shimokubo S, Arima N, Baba M. 2000.
Production of functionally deficient dendritic cells from HTLV-I-infected
monocytes: implications for the dendritic cell defect in adult T cell leuke-
mia. Virology 274:140 –148. http://dx.doi.org/10.1006/viro.2000.0445.
18. Nascimento CR, Lima MA, de Andrada Serpa MJ, Espindola O, Leite
AC, Echevarria-Lima J. 2011. Monocytes from HTLV-1-infected patients
are unable to fully mature into dendritic cells. Blood 117:489 – 499. http:
//dx.doi.org/10.1182/blood-2010-03-272690.
19. Valeri VW, Hryniewicz A, Andresen V, Jones K, Fenizia C, Bialuk I,
Chung HK, Fukumoto R, Parks RW, Ferrari MG, Nicot C, Cecchinato
V, Ruscetti F, Franchini G. 2010. Requirement of the human T-cell
leukemia virus p12 and p30 products for infectivity of human dendritic
cells and macaques but not rabbits. Blood 116:3809 –3817. http://dx.doi
.org/10.1182/blood-2010-05-284141.
20. Datta A, Sinha-Datta U, Dhillon NK, Buch S, Nicot C. 2006. The
HTLV-I p30 interferes with TLR4 signaling and modulates the release of
pro- and anti-inflammatory cytokines from human macrophages. J. Biol.
Chem. 281:23414 –23424. http://dx.doi.org/10.1074/jbc.M600684200.
21. Zhang W, Nisbet JW, Bartoe JT, Ding W, Lairmore MD. 2000. Human
T-lymphotropic virus type 1 p30(II) functions as a transcription factor
and differentially modulates CREB-responsive promoters. J. Virol. 74:
11270 –11277. http://dx.doi.org/10.1128/JVI.74.23.11270-11277.2000.
22. Kanno Y, Levi BZ, Tamura T, Ozato K. 2005. Immune cell-specific
amplification of interferon signaling by the IRF-4/8-PU. 1 complex. J.
Interferon Cytokine Res. 25:770 –779. http://dx.doi.org/10.1089/jir.2005
.25.770.
23. Marecki S, Fenton MJ. 2002. The role of IRF-4 in transcriptional regula-
tion. J. Interferon Cytokine Res. 22:121–133. http://dx.doi.org/10.1089
/107999002753452737.
24. Lehtonen A, Ahlfors H, Veckman V, Miettinen M, Lahesmaa R,
Julkunen I. 2007. Gene expression profiling during differentiation of
human monocytes to macrophages or dendritic cells. J. Leukoc. Biol. 82:
710 –720. http://dx.doi.org/10.1189/jlb.0307194.
25. Koralnik IJ, Fullen J, Franchini G. 1993. The p12I, p13II, and p30II
proteins encoded by human T-cell leukemia/lymphotropic virus type I
open reading frames I and II are localized in three different cellular com-
partments. J. Virol. 67:2360 –2366.
26. Li S, Labrecque S, Gauzzi MC, Cuddihy AR, Wong AH, Pellegrini S,
Matlashewski GJ, Koromilas AE. 1999. The human papilloma virus
(HPV)-18 E6 oncoprotein physically associates with Tyk2 and impairs
p30 Inhibits TLR Signaling in Monocyte/Dendritic Cells
January 2014 Volume 88 Number 1 jvi.asm.org 401
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

Jak-STAT activation by interferon-alpha. Oncogene 18:5727–5737. http:
//dx.doi.org/10.1038/sj.onc.1202960.
27. Schmidt M, Bies J, Tamura T, Ozato K, Wolff L. 2004. The interferon
regulatory factor ICSBP/IRF-8 in combination with PU.1 up-regulates
expression of tumor suppressor p15(Ink4b) in murine myeloid cells.
Blood 103:4142– 4149. http://dx.doi.org/10.1182/blood-2003-01-0285.
28. Schroder K, Lichtinger M, Irvine KM, Brion K, Trieu A, Ross IL, Ravasi
T, Stacey KJ, Rehli M, Hume DA, Sweet MJ. 2007. PU.1 and ICSBP
control constitutive and IFN-gamma-regulated Tlr9 gene expression in
mouse macrophages. J. Leukoc. Biol. 81:1577–1590. http://dx.doi.org/10
.1189/jlb.0107036.
29. Hengel H, Koszinowski UH, Conzelmann KK. 2005. Viruses know it all:
new insights into IFN networks. Trends Immunol. 26:396 – 401. http://dx
.doi.org/10.1016/j.it.2005.05.004.
30. Hughes R, Towers G, Noursadeghi M. 2012. Innate immune interferon
responses to human immunodeficiency virus-1 infection. Rev. Med. Vi-
rol. 22:257–266. http://dx.doi.org/10.1002/rmv.1708.
31. Wang BX, Fish EN. 2012. The yin and yang of viruses and interferons. Trends
Immunol. 33:190–197. http://dx.doi.org/10.1016/j.it.2012.01.004.
32. Severa M, Fitzgerald KA. 2007. TLR-mediated activation of type I IFN
during antiviral immune responses: fighting the battle to win the war.
Curr. Top. Microbiol. Immunol. 316:167–192. http://dx.doi.org/10.1007
/978-3-540-71329-6_9.
33. Van Prooyen N, Gold H, Andresen V, Schwartz O, Jones K, Ruscetti F,
Lockett S, Gudla P, Venzon D, Franchini G. 2010. Human T-cell leu-
kemia virus type 1 p8 protein increases cellular conduits and virus trans-
mission. Proc. Natl. Acad. Sci. U. S. A. 107:20738 –20743. http://dx.doi
.org/10.1073/pnas.1009635107.
34. Kirk PD, Witkover A, Courtney A, Lewin AM, Wait R, Stumpf MP,
Richardson S, Taylor GP, Bangham CR. 2011. Plasma proteome analysis
in HTLV-1-associated myelopathy/tropical spastic paraparesis. Retrovi-
rology 8:81. http://dx.doi.org/10.1186/1742-4690-8-81.
35. Matsuzaki T, Nakagawa M, Nagai M, Usuku K, Higuchi I, Arimura K,
Kubota H, Izumo S, Akiba S, Osame M. 2001. HTLV-I proviral load
correlates with progression of motor disability in HAM/TSP: analysis of
239 HAM/TSP patients including 64 patients followed up for 10 years. J.
Neurovirol. 7:228 –234. http://dx.doi.org/10.1080/13550280152403272.
36. Montanheiro PA, Oliveira AC, Posada-Vergara MP, Milagres AC, Tauil
C, Marchiori PE, Duarte AJ, Casseb J. 2005. Human T-cell lymphotropic
virus type I (HTLV-I) proviral DNA viral load among asymptomatic pa-
tients and patients with HTLV-I-associated myelopathy/tropical spastic
paraparesis. Braz. J. Med. Biol. Res. 38:1643–1647. http://dx.doi.org/10
.1590/S0100-879X2005001100011.
37. Yamano Y, Nagai M, Brennan M, Mora CA, Soldan SS, Tomaru U,
Takenouchi N, Izumo S, Osame M, Jacobson S. 2002. Correlation of
human T-cell lymphotropic virus type 1 (HTLV-1) mRNA with proviral
DNA load, virus-specific CD8() T cells, and disease severity in HTLV-
1-associated myelopathy (HAM/TSP). Blood 99:88 –94. http://dx.doi.org
/10.1182/blood.V99.1.88.
38. Wissing S, Galloway NL, Greene WC. 2010. HIV-1 Vif versus the
APOBEC3 cytidine deaminases: an intracellular duel between pathogen
and host restriction factors. Mol. Aspects Med. 31:383–397. http://dx.doi
.org/10.1016/j.mam.2010.06.001.
39. Baydoun H, Duc-Dodon M, Lebrun S, Gazzolo L, Bex F. 2007. Regu-
lation of the human T-cell leukemia virus gene expression depends on the
localization of regulatory proteins Tax, Rex and p30II in specific nuclear
subdomains. Gene 386:191–201. http://dx.doi.org/10.1016/j.gene.2006
.09.008.
40. Ghorbel S, Sinha-Datta U, Dundr M, Brown M, Franchini G, Nicot C.
2006. Human T-cell leukemia virus type I p30 nuclear/nucleolar retention
is mediated through interactions with RNA and a constituent of the 60 S
ribosomal subunit. J. Biol. Chem. 281:37150 –37158. http://dx.doi.org/10
.1074/jbc.M603981200.
41. Weber F, Kochs G, Haller O. 2004. Inverse interference: how viruses fight
the interferon system. Viral Immunol. 17:498 –515. http://dx.doi.org/10
.1089/vim.2004.17.498.
42. Journo C, Mahieux R. 2011. HTLV-1 and innate immunity. Viruses
3:1374 –1394. http://dx.doi.org/10.3390/v3081374.
43. Wang X, Li M, Zheng H, Muster T, Palese P, Beg AA, Garcia-Sastre A.
2000. Influenza A virus NS1 protein prevents activation of NF-kappaB and
induction of alpha/beta interferon. J. Virol. 74:11566 –11573. http://dx
.doi.org/10.1128/JVI.74.24.11566-11573.2000.
44. Komatsu T, Takeuchi K, Yokoo J, Gotoh B. 2004. C and V proteins of
Sendai virus target signaling pathways leading to IRF-3 activation for the
negative regulation of interferon-beta production. Virology 325:137–148.
http://dx.doi.org/10.1016/j.virol.2004.04.025.
45. Naniche D, Yeh A, Eto D, Manchester M, Friedman RM, Oldstone MB.
2000. Evasion of host defenses by measles virus: wild-type measles virus infec-
tion interferes with induction of alpha/beta interferon production. J. Virol.
74:7478–7484. http://dx.doi.org/10.1128/JVI.74.16.7478-7484.2000.
46. Basler CF, Mikulasova A, Martinez-Sobrido L, Paragas J, Muhlberger E,
Bray M, Klenk HD, Palese P, Garcia-Sastre A. 2003. The Ebola virus
VP35 protein inhibits activation of interferon regulatory factor 3. J. Virol.
77:7945–7956. http://dx.doi.org/10.1128/JVI.77.14.7945-7956.2003.
47. Foy E, Li K, Wang C, Sumpter R, Jr, Ikeda M, Lemon SM, Gale M, Jr.
2003. Regulation of interferon regulatory factor-3 by the hepatitis C virus
serine protease. Science 300:1145–1148. http://dx.doi.org/10.1126
/science.1082604.
48. Roy S, Katze MG, Parkin NT, Edery I, Hovanessian AG, Sonenberg N.
1990. Control of the interferon-induced 68-kilodalton protein kinase by
the HIV-1 tat gene product. Science 247:1216 –1219. http://dx.doi.org/10
.1126/science.2180064.
49. Sheehy AM, Gaddis NC, Choi JD, Malim MH. 2002. Isolation of a human
gene that inhibits HIV-1 infection and is suppressed by the viral Vif protein.
Nature 418:646–650. http://dx.doi.org/10.1038/nature00939.
50. Fenner JE, Starr R, Cornish AL, Zhang JG, Metcalf D, Schreiber RD,
Sheehan K, Hilton DJ, Alexander WS, Hertzog PJ. 2006. Suppressor of
cytokine signaling 1 regulates the immune response to infection by a
unique inhibition of type I interferon activity. Nat. Immunol. 7:33–39.
http://dx.doi.org/10.1038/ni1287.
51. Oliere S, Hernandez E, Lezin A, Arguello M, Douville R, Nguyen TL,
Olindo S, Panelatti G, Kazanji M, Wilkinson P, Sekaly RP, Cesaire R,
Hiscott J. 2010. HTLV-1 evades type I interferon antiviral signaling by
inducing the suppressor of cytokine signaling 1 (SOCS1). PLoS Pathog.
6:e1001177. http://dx.doi.org/10.1371/journal.ppat.1001177.
52. Smith D, Buckle GJ, Hafler DA, Frank DA, Hollsberg P. 1999. HTLV-
I-infected T cells evade the antiproliferative action of IFN-beta. Virology
257:314 –321. http://dx.doi.org/10.1006/viro.1999.9679.
53. Feng X, Ratner L. 2008. Human T-cell leukemia virus type 1 blunts
signaling by interferon alpha. Virology 374:210 –216. http://dx.doi.org/10
.1016/j.virol.2007.12.036.
54. Zhang J, Yamada O, Kawagishi K, Araki H, Yamaoka S, Hattori T,
Shimotohno K. 2008. Human T-cell leukemia virus type 1 Tax modulates
interferon-alpha signal transduction through competitive usage of the co-
activator CBP/p300. Virology 379:306 –313. http://dx.doi.org/10.1016/j
.virol.2008.06.035.
55. Kinpara S, Kijiyama M, Takamori A, Hasegawa A, Sasada A, Masuda T,
Tanaka Y, Utsunomiya A, Kannagi M. 2013. Interferon-alpha (IFN-
alpha) suppresses HTLV-1 gene expression and cell cycling, while IFN-
alpha combined with zidovudine induces p53 signaling and apoptosis in
HTLV-1-infected cells. Retrovirology 10:52. http://dx.doi.org/10.1186
/1742-4690-10-52.
Fenizia et al.
402 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.