---
id: "edwards-2014-palmitoylation"
title: "Palmitoylation and p8-Mediated Human T-Cell Leukemia Virus Type 1 Transmission"
authors:
  - "Dustin Edwards"
  - "Risaku Fukumoto"
  - "Maria Fernanda de Castro-Amarante"
  - "Luiz Carlos Junior Alcantara"
  - "Bernardo Galvão-Castro"
  - "Robyn Washington Parks"
  - "Cynthia Pise-Masison"
  - "Genoveffa Franchini"
venue: "Journal of Virology"
year: 2014
date: "2014-02-15"
doi: "10.1128/jvi.03444-13"
url: "/research/publications/10-1128-jvi-03444-13/"
pdf: "/research/publications/10-1128-jvi-03444-13/dustin-edwards-10-1128-jvi-03444-13.pdf"
pmc: "https://pmc.ncbi.nlm.nih.gov/articles/PMC3911539/"
openAccess: true
citedBy: 12
citedBySource: "OpenAlex, read 2026-09-12"
---
# Palmitoylation and p8-Mediated Human T-Cell Leukemia Virus Type 1 Transmission

Mutating cysteine 39 stops HTLV-1 p8 and p12 from dimerizing and being palmitoylated, but p8 still reaches the cell surface and spreads the virus.

## Abstract

The orf-I gene of human T-cell leukemia type 1 (HTLV-1) encodes p8 and p12 and has a conserved cysteine at position 39. p8 and p12 form disulfide-linked dimers, and only the monomeric forms of p8 and p12 are palmitoylated. Mutation of cysteine 39 to alanine (C39A) abrogated dimerization and palmitoylation of both proteins. However, the ability of p8 to localize to the cell surface and to increase cell adhesion and viral transmission was not affected by the C39A mutation.

## Full text

Machine-extracted from the PDF linked above. It carries the artifacts that come with reading a typeset two-column page: running heads, figure captions in the flow of the prose, and words broken across line ends. The abstract above is the registry's deposit and is the authoritative text.

Palmitoylation and p8-Mediated Human T-Cell Leukemia Virus Type
1 Transmission
Dustin Edwards,a Risaku Fukumoto,a Maria Fernanda de Castro-Amarante,a Luiz Carlos Junior Alcantara,a,b Bernardo Galvão-Castro,b,c
Robyn Washington Parks,a Cynthia Pise-Masison,a Genoveffa Franchinia
Animal Models and Retroviral Vaccines Section, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Bethesda, Maryland, USAa; Gonçalo
Moniz Research Center, Oswaldo Cruz Foundation, Salvador, Bahia, Brazilb; Bahia School of Medicine and Public Health, Bahia Foundation for Science Development,
Salvador, Bahia, Brazilc
The orf-I gene of human T-cell leukemia type 1 (HTLV-1) encodes p8 and p12 and has a conserved cysteine at position 39. p8 and
p12 form disulfide-linked dimers, and only the monomeric forms of p8 and p12 are palmitoylated. Mutation of cysteine 39 to
alanine (C39A) abrogated dimerization and palmitoylation of both proteins. However, the ability of p8 to localize to the cell sur-
face and to increase cell adhesion and viral transmission was not affected by the C39A mutation.
Human T-cell leukemia virus type 1 (HTLV-1) is the etiological
agent of adult T-cell leukemia (ATL) and tropical spastic
paraparesis/HTLV-1-associated myelopathy (TSP/HAM) (1–5).
The HTLV-1 genome encodes structural and enzymatic proteins
and, at the 3= end, contains four open reading frames (ORFs) (6).
Singly spliced RNA from orf-I encodes a 12-kDa endoplasmic re-
ticulum (ER) resident protein, p12 (7–10). The membrane-asso-
ciated p12 protein is proteolytically cleaved at the amino terminus
to remove a noncanonical ER retention/retrieval signal that re-
sults in the generation of p8, which traffics to the cell surface (9).
HTLV-1 p12 and p8 have seemingly opposite effects on T-cell
activation (11). The p12 protein promotes T-cell activation by
binding to calcineurin to increase ER calcium influx and nuclear
factor of activated T cell (NFAT) activity (12–14). HTLV-1 p12
also increases T-cell proliferation by binding to the  and c
chains of the interleukin 2 (IL-2) receptor, resulting in STAT5
phosphorylation, which activates IL-2 production (15, 16). In
contrast, the p8 protein induces anergy in T-cell receptor-stimu-
lated cells by downmodulating signaling at the immunological
synapse through decreased phosphorylation of linker of activation
for T cells (LAT), phospholipase C-1 (PLC-1), and Vav (11).
Additionally, p8 decreases cell spreading and actin polymerization
upon T-cell receptor (TCR) engagement (17), and the orf-I gene
protein products increase the motility and migration of T cells
toward chemokines (18). In stimulated T cells, p8 increases the
virological synapse formation, the length of cellular conduits, and
viral infectivity (17).
However, the mechanism by which p8 translocates from the
ER to the cell surface remains unclear. We investigated whether
(Fig. 1A) a highly conserved single cysteine residue at position 39
(C39) could form intermolecular disulfide bonds (9), contribute
to dimer formation, and regulate the diverse functions of p8 and
p12. At first, we immunoprecipitated protein extract from 293T
cells transfected with the orf-I cDNA. The immune complexes
were treated or not with the reducing agent -mercaptoethanol
(-ME) and resolved in the first dimension by SDS-PAGE. High-
molecular-weight bands observed in the nonreducing conditions
were resolved to p12 and p8 in the presence of -ME (Fig. 1B,
lanes 1and 3, respectively). Parallel lanes were excised and placed
horizontally at the top of another gel to perform a secondary elec-
trophoresis in reducing or nonreducing conditions. In nonreduc-
ing conditions, the predominate high-molecular-weight protein
bands were found to contain only p12 or p12 and p8, while the
lower faint band was constituted of dimeric p8 (Fig. 1B, lane 1 and
panel 2). The reduced immune complexes (lane 3) migrated with
a size compatible to that of monomeric p12 and p8 (panel 4).
These data are consistent with the ability of these proteins to form
homo- and heterodimers. In order to minimize p12 and p8 dimer
formation after cell lysis, immunoprecipitates were treated with
iodoacetamide (IAN), which covalently modifies the reactive sul-
fhydryl group on cysteine residues. Immunoblot analysis showed
that dimer formation occurred similarly in the presence or ab-
sence of IAN (data not shown).
We mutated C39 to alanine (C39A). pME and HA-tagged WT,
G29S, and 29 orf-I expression plasmids and the pACH and pAB
molecular clones were previously described (1, 11, 19). The orf-I
expression plasmids were modified with the addition of a Kozak
sequence (underlined). Products were generated by PCR using the
oligonucleotides WT-Fwd (5= ATTACTCGAGGCCACCATGCT
GTTTCGCCTTC), 29-Fwd (5= ATTACTCGAGGCCACCATG
CTTCTTCTCCGCC), and WT and 29-Rev (5= TCGGTCTAGA
AACAACAACAATTGCATT). The PCR products were cleaved
with XhoI and XbaI and ligated into the pME backbone plasmid.
The C39A mutant was generated by PCR from the QuikChange II
site-directed mutagenesis kit (Agilent, Santa Clara, CA) using site-
specific mutagenic oligonucleotides. The oligonucleotides C39A-
Fwd (5= CCTCCTGCGCCGGCCCTTCTCCTCTTCCTTC) and
C39A-Rev (5= GAAAAGGAAGGAAGAGGAGAAG) were used.
The sequences of all plasmid clones were analyzed to confirm the
underlined changes.
Protein extracts from the transfected 293T cells were treated or
not with -ME and resolved on tricine gels, as previously de-
scribed (9, 11) (Fig. 1C). Immunoblotting of untreated protein
extracts from cells expressing the orf-I gene detected the p12 and
Received 21 November 2013 Accepted 21 November 2013
Published ahead of print 27 November 2013
Address correspondence to Genoveffa Franchini, franchig@mail.nih.gov.
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/JVI.03444-13
February 2014 Volume 88 Number 4 Journal of Virology p. 2319 –2322 jvi.asm.org 2319
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

p8 monomers, as well as slower-migrating bands (Fig. 1C, lane 3)
that were not observed following -ME treatment (Fig. 1C, lane 4)
or when cysteine 39 was mutated to alanine (Fig. 1C, lanes 5 and
6), demonstrating the contribution of C39A to dimer formation.
In HTLV-1-infected individuals, polymorphisms in the proximity
of the cleavage site, within p12, resulted in different ratios of p8
and p12 expression. The natural mutation of glycine 29 to serine
(Fig. 1A) resulted in the G29S mutant that produces mainly p12
(9). Expression of G29S demonstrated the p12 monomer and a
single slower-migrating complex that was reduced to p12 by
-ME (Fig. 1C, lanes 7 and 8). Indeed, the replacement of cysteine
39 with alanine into G29S (G29S/C39A mutant) resulted in the
disappearance of the slow-migrating protein band in nonreducing
conditions (Fig. 1C, lane 9). As expected, expression of the 29
plasmid encoding only p8 (9) resulted in the detection of the p8
monomer and a single slower-migrating complex that was re-
duced to the monomeric form by treatment with -ME (Fig. 1C,
lanes 11 and 12). Accordingly, mutation of cysteine 39 to alanine
in the 29/C39A mutant resulted in the disappearance of the
slow-migrating form observed in the 29 mutant (Fig. 1C, com-
pare lanes 11, 13, and 14). The difference in the slower-migrating
bands in lanes 7 and 11 is compatible with a difference in size of
the p12 and p8 dimers. Together, the above-described findings
demonstrate that the dimers formed by p12 and p8 are disulfide
linked at cysteine 39.
Palmitoylation of cysteine residues appears to be essential for
the localization of several transmembrane signaling proteins to
the cell surface (19, 20). We therefore hypothesized that p8 and
p12 monomers may also be palmitoylated and that this modifica-
tion may affect p8 localization to the cell surface. 293T cells were
transfected with the WT orf-I gene or the C39A mutants and met-
abolically labeled (21) with [3H]palmitic acid (Fig. 2A). Immuno-
precipitated protein extracts from these cells were either treated or
not with -ME and resolved by SDS-PAGE. As expected, immu-
noblot analysis demonstrated that dimer formation was inhibited
by treatment with reducing agent or by mutation at C39 (Fig. 2A,
lanes 1 to 6). Fluorography, however, revealed that both the mo-
nomeric form of p12 and p8 are palmitoylated and that the palmi-
toylated proteins did not form dimers in the absence of -ME
(Fig. 2A, lanes 7 and 8). The C39 mutant was not palmitoylated,
FIG 1 The p12 and p8 proteins form disulfide-linked dimers. (A) Protein amino acid sequence (single-letter amino acid code) HTLV-1 orf-I gene protein
product. The arrowhead indicates a possible site of protein cleavage (9), the asterisk denotes the position of cysteine 39, and underlined residues show the
sequence of the HA tag. (B) Extract from 293T cells transfected with the HA-tagged wild-type orf-I gene protein product expression plasmid was treated in the
absence (lane 1) or the presence (lane 3) of -mercaptoethanol (-ME) and resolved by SDS-PAGE in the first dimension. Gel lanes were excised and resolved
in a second dimension in nonreducing (panel 2) and reducing conditions (panel 4). The position of heterodimers is indicated by the horizontal arrows. Long
arrows at the left and top of the figure represent the electrophoresis’s direction. (C) Extracts from 293T cells transfected with HA-tagged orf-I gene WT and
mutants were incubated in the presence or absence of the reducing agent -ME. Proteins were resolved by SDS-PAGE and immunoblotted with antibodies to HA.
The arrowheads at left indicate the positions of p12 (filled) and p8 (hollow).
Edwards et al.
2320 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

demonstrating that palmitoylation of both the p12 and p8 pro-
teins occurs on C39 (Fig. 2A, lane 9). These results indicate that the
p8 and p12 proteins can either dimerize or undergo palmitoyla-
tion and remain monomeric, suggesting a possible mechanism of
functional regulation of p8 and p12 functions.
We next tested whether the C39A mutant localizes to the cell
surface using MT-2 cells cotransfected with a membrane marker,
GFP-GPI, together with pME, 29, or 29/C39A expression plas-
mids. Forty-eight hours posttransfection, cells were incubated
with poly-lysine-coated coverslips to favor cell spreading and vi-
sualization. Cells were then fixed, permeabilized, and immuno-
stained with anti-HA, as previously described (9, 11). As shown in
Fig. 2B, the membrane marker GFP-GPI (green) localized exclu-
sively to the plasma membrane of MT-2 cells. The 29 protein
(p8) (red) accumulated in both the cytoplasm, as reported previ-
ously (9, 11), and at the cell surface similar to GFP-GPI (yellow)
(Fig. 2B, middle). The colocalization of the 29 and 29/C39A
proteins with GFP-GPI was analyzed by line scan measurements
in Metamorph (data not shown). We observed no difference in
localization of the 29/C39A protein compared to the 29 pro-
tein, suggesting that C39 is dispensable for cell surface localization
of p8 (Fig. 2B).
We have previously shown that p8 increases conduit forma-
tion, cell contact, and virus transmission in naturally infected T
cells (17). Upon direct cell contact with a neighboring cell, p8
polarizes at the cell-to-cell junction and mediates conduit forma-
tion (17). Enhanced viral infectivity may therefore be achieved
both by virus transmissions along these cellular conduits and from
increased cell-to-cell contact (17). To determine the role of C39A
mutation in the ability of p8 to increase viral infectivity and cell-
to-cell adhesion, the HTLV-1 producer MT-2 cell line was trans-
fected with orf-I gene expression plasmids expressing mainly p12
FIG 2 Functional consequence of palmitoylation at C39 of p12 and p8. (A) 293T cells transfected with empty vector or HA-tagged orf-I gene protein product
expression plasmids and parallel plates were metabolically labeled with [3H]palmitic acid. Extract from unlabeled transfected cells was immunoprecipitated with
an antibody to HA and treated in the presence or absence of -mercaptoethanol. Immunoprecipitated proteins were resolved by SDS-PAGE and analyzed by
immunoblotting with an antibody to HA (lanes 1 to 6). The [3H]palmitic acid-labeled extract was analyzed by fluorography (lanes 7 to 9) following immuno-
precipitation. The arrowheads at the left indicate the positions of p12 (filled) and p8 (hollow). (B) MT-2 cells were transfected with GFP-GPI, together with pME,
29, or 29/C39A expression plasmids. Cells were then visualized by confocal microscopy. GFP-GPI is shown in green and p8 in red. (C)Transfected MT-2 cells
were cocultivated for 48 h with BHK1E6 cells containing a lacZ reporter gene bound to a Tax-responsive promoter. Monolayers were washed, fixed, and stained
with X-Gal solution, and -galactosidase-expressing cells were counted by bright-field microscopy. Control pME-transfected cells were set to 1, and infectivity
of cells transfected with orf-I gene protein product expression plasmids was determined relative to this value. Error bars represent the standard errors of the means
from three independent experiments. (D) Transfected MT-2 cells were incubated on ICAM-1-coated coverslips and their nuclei stained with crystal violet. Cells
were washed and lysed, and released stain was measured at 570 m. Absorbance for control pME-transfected cells was set to 1, and adhesion of cells transfected
with the orf-I gene protein product expression plasmids was determined relative to this value. The error bars represent the standard error of the means from three
independent experiments. (E) Protein extract from MT-2 cells transfected with HA-tagged orf-I gene protein product expression plasmids was resolved by
SDS-PAGE and immunoblotted with antibodies to HA. The arrowheads at the left indicate the positions of p12 (filled) and p8 (hollow).
Palmitoylation and p8-Mediated HTLV-1 Transmission
February 2014 Volume 88 Number 4 jvi.asm.org 2321
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.

or p8 carrying a cysteine or an alanine at position 39. HTLV-1-
infected MT-2 cells, following transfection with the pME vector or
G29S (expresses mainly p12), G29S/C39A, 29 (produces mainly
p8), or 29/C39A cDNA, were cocultivated for 48 h with BHK1E6
cells containing a lacZ reporter gene whose expression is driven by
Tax. Monolayers were washed, fixed, and stained with 5-bromo-
4-chloro-3-indolyl--D-galactopyranoside (X-Gal) solution, and
-galactosidase-expressing cells were counted by bright-field mi-
croscopy, as previously described (17). Cells transfected with
G29S or the G29S/C39A cDNAs transmitted similar levels of
HTLV-1 to BHK1E6 cells. In contrast, there was a 3-fold increase
in the infectivity in cells expressing 29 protein, as expected (17),
and mutation of cysteine 39 did not affect virus transmission (Fig.
2C). To assess the underlying mechanism, the same batch of trans-
fected MT-2 cells was incubated in parallel, on ICAM-1/Fc-coated
coverslips, and then fixed, and their nuclei were stained with crys-
tal violet. The cells were washed and incubated in a solution that
releases the stain, and absorbance was measured. As shown in Fig.
2D, expression of p8 increased MT-2 cell adhesion to ICAM-1-
coated coverslips 3-fold over that of cells transfected with empty
vector, and mutation of cysteine 39 to alanine did not affect the
ability to increase cell adhesion of p8. The increase in viral trans-
mission or cell adhesion mediated by p8 or by the 29/C39A pro-
tein was not due to differences in the expression of the proteins
(Fig. 2E). Overall, our results demonstrate that dimerization and
palmitoylation are dispensable in p8-augmented cell-to-cell adhe-
sion and viral infectivity.
It seems unlikely for palmitoylation of orf-I-encoded proteins
to have been conserved without affecting protein function.
Whether palmitoylation or dimerization may be required for the
p12/p8-mediated downregulation of MHC class I or STAT5 acti-
vation will require further studies.
ACKNOWLEDGMENTS
We thank Teresa Habina for editorial assistance, Lawrence E. Samelson
for helpful discussion, and Tatyana Karpova and Tatsuya Morisaki for
help with the confocal microscopy and analysis.
REFERENCES
1. Gessain A, Barin F, Vernant J-C, Gout O, Maurs L, Calendar A, de The
G. 1985. Antibodies to human T-lymphotropic virus type I in patients
with tropical spastic paraparesis. Lancet ii:407– 410.
2. Nakamura F, Kajihara H, Nakamura M, Sasaki H, Kumamoto T, Okada
K. 1989. HTLV-1 associated myelopathy in an HTLV-1 and HBV double
carrier family: report of a case and the mode of vertical transmission of
both viruses. J. Gastroenterol. Hepatol. 4:387–390. http://dx.doi.org/10
.1111/j.1440-1746.1989.tb00850.x.
3. Osame M, Usuku K, Izumo S, Ijichi N, Amitani H, Igata A. 1986.
HTLV-I associated myelopathy, a new clinical entity. Lancet i:1031–1032.
4. Poiesz BJ, Ruscetti FW, Gazdar AF, Bunn PA, Minna JD, Gallo RC.
1980. Detection and isolation of type C retrovirus particles from fresh and
cultured lymphocytes of a patient with cutaneous T-cell lymphoma. Proc.
Natl. Acad. Sci. U. S. A. 77:7415–7419. http://dx.doi.org/10.1073/pnas.77
.12.7415.
5. Yoshida M, Miyoshi I, Hinuma Y. 1982. Isolation and characterization of
retrovirus from cell lines of human adult T-cell leukemia and its implica-
tion in the disease. Proc. Natl. Acad. Sci. U. S. A. 79:2031–2035. http://dx
.doi.org/10.1073/pnas.79.6.2031.
6. Seiki M, Hattori S, Kirayama Y, Yoshida M. 1983. Human T-cell leu-
kemia/lymphotropic virus: complete nucleotide sequence of the provirus
genome integrated in leukemia cell DNA. Proc. Natl. Acad. Sci. U. S. A.
80:3618 –3622. http://dx.doi.org/10.1073/pnas.80.12.3618.
7. Berneman ZN, Gartenhaus RB, Reitz MS, Jr, Blattner WA, Manns A,
Hanchard B, Ikehara O, Gallo RC, Klotman MK. 1992. Expression of
alternatively spliced human T-lymphotropic virus type I (HTLV-I) pX
mRNA in infected cell lines and in primary uncultured cells from patients
with adult T-cell leukemia/lymphoma and healthy carriers. Proc. Natl.
Acad. Sci. U. S. A. 89:3005–3009. http://dx.doi.org/10.1073/pnas.89.7
.3005.
8. Ciminale V, Pavlakis GN, Derse D, Cunningham CP, Felber BK. 1992.
Complex splicing in the human T-cell leukemia virus (HTLV) family of
retroviruses: novel mRNAs and proteins produced by HTLV-I. J. Virol.
66:1737–1745.
9. Fukumoto R, Andresen V, Bialuk I, Cecchinato V, Walser JC, Valeri
VW, Nauroth JM, Gessain A, Nicot C, Franchini G. 2009. In vivo genetic
mutations define predominant functions of the human T-cell leukemia/
lymphoma virus p12I protein. Blood 113:3726 –3734. http://dx.doi.org
/10.1182/blood-2008-04-146928.
10. Koralnik I, Gessain A, Klotman ME, Lo Monico A, Berneman ZN,
Franchini G. 1992. Protein isoforms encoded by the pX region of the
human T-cell leukemia/lymphotropic virus type I. Proc. Natl. Acad. Sci.
U. S. A. 89:8813– 8817. http://dx.doi.org/10.1073/pnas.89.18.8813.
11. Fukumoto R, Dundr M, Nicot C, Adams A, Valeri VW, Samelson LE,
Franchini G. 2007. Inhibition of T-cell receptor signal transduction and
viral expression by the linker for activation of T cells-interacting p12I
protein of human T-cell leukemia/lymphoma virus type 1. J. Virol. 81:
9088 –9099. http://dx.doi.org/10.1128/JVI.02703-06.
12. Albrecht B, D’Souza CD, Ding W, Tridandapani S, Coggeshall KM,
Lairmore MD. 2002. Activation of nuclear factor of activated T cells by
human T-lymphotropic virus type 1 accessory protein p12(I). J. Virol.
76:3493–3501. http://dx.doi.org/10.1128/JVI.76.7.3493-3501.2002.
13. Ding W, Albrecht B, Kelley RE, Muthusamy N, Kim SJ, Altschuld RA,
Lairmore MD. 2002. Human T-cell lymphotropic virus type 1 p12(I)
expression increases cytoplasmic calcium to enhance the activation of nu-
clear factor of activated T cells. J. Virol. 76:10374 –10382. http://dx.doi.org
/10.1128/JVI.76.20.10374-10382.2002.
14. Kim SJ, Ding W, Albrecht B, Green PL, Lairmore MD. 2003. A conserved
calcineurin-binding motif in human T lymphotropic virus type 1 p12I functions
tomodulatenuclearfactorofactivatedTcellactivation.J.Biol.Chem.278:15550–
15557. http://dx.doi.org/10.1074/jbc.M210210200.
15. Mulloy JC, Crowley RW, Fullen J, Leonard WJ, Franchini G. 1996. The
human T-cell leukemia/lymphotropic virus type I p12I protein binds the in-
terleukin-2 receptor  and c chains and affects their expression on the cell
surface. J. Virol. 70:3599–3605.
16. Nicot C, Mulloy JC, Ferrari MG, Johnson JM, Fu K, Fukumoto R, Trovato R,
Fullen J, Leonard WJ, Franchini G. 2001. HTLV-1 p12(I) protein enhances
STAT5 activation and decreases the interleukin-2 requirement for proliferation of
primary human peripheral blood mononuclear cells. Blood 98:823–829. http:
//dx.doi.org/10.1182/blood.V98.3.823.
17. Van Prooyen N, Gold H, Andresen V, Schwartz O, Jones K, Ruscetti F,
Lockett S, Gudla P, Venzon D, Franchini G. 2010. Human T-cell leu-
kemia virus type 1 p8 protein increases cellular conduits and virus trans-
mission. Proc. Natl. Acad. Sci. U. S. A. 107:20738 –20743. http://dx.doi
.org/10.1073/pnas.1009635107.
18. Taylor JM, Brown M, Nejmeddine M, Kim KJ, Ratner L, Lairmore M,
Nicot C. 2009. Novel role for interleukin-2 receptor-Jak signaling in ret-
rovirus transmission. J. Virol. 83:11467–11476. http://dx.doi.org/10.1128
/JVI.00952-09.
19. Linder ME, Deschenes RJ. 2007. Palmitoylation: policing protein stability
and traffic. Nat. Rev. Mol. Cell Biol. 8:74 – 84. http://dx.doi.org/10.1038
/nrm2084.
20. Veit M, Serebryakova MV, Kordyukova LV. 2013. Palmitoylation of
influenza virus proteins. Biochem. Soc. Trans. 41:50 –55. http://dx.doi.org
/10.1042/BST20120210.
21. Rouquette-Jazdanian AK, Pelassy C, Breittmayer JP, Cousin JL, Aussel
C. 2002. Metabolic labelling of membrane microdomains/rafts in Jurkat
cells indicates the presence of glycerophospholipids implicated in signal
transduction by the CD3 T-cell receptor. Biochem. J. 363:645– 655. http:
//dx.doi.org/10.1042/0264-6021:3630645.
Edwards et al.
2322 jvi.asm.org Journal of Virology
Downloaded from https://journals.asm.org/journal/jvi on 26 July 2026 by 156.146.253.207.