How Can We Help?
For PCR amplification of reticuloendotheliosis virus (REV) nucleotides 2500–3075 at the pol gene (protease and reverse transcriptase).
Forward primer: 5’•CAAATAATAGATTTTCTAGTAGATACGGGA•3’
Reverse primer: 5’•AGTGGACGGGTCTCAGGA•3’
Materials
- NEB OneTaq® Hot Start 2X Master Mix
- NEB 100 bp ladder
- 2% agarose gel in TBE
Extension temperature is dependent on polymerase
| Step | Temperature (°C) | Time |
| initial denaturation | 95 | 10 min. |
| 15 cycles | 95 | 30 sec. |
| 60◺50 | 45 sec. | |
| 68 | 120 sec. | |
| 20 cycles | 95 | 30 sec. |
| 50 | 60 sec. | |
| 68 | 120 sec. | |
| extension | 68 | 9 min. |
| hold | 10 | ∞ |
