How Can We Help?
PCR REV pol 2500-3750
For PCR amplification of reticuloendotheliosis virus (REV) nucleotides 2500–3075 at the pol gene (protease and reverse transcriptase).
Forward primer: 5’•CAAATAATAGATTTTCTAGTAGATACGGGA•3’
Reverse primer: 5’•AGTGGACGGGTCTCAGGA•3’
Materials
- NEB OneTaq® Hot Start 2X Master Mix
- NEB 100 bp ladder
- 2% agarose gel in TBE
Extension temperature is dependent on polymerase
Step | Temperature (°C) | Time |
initial denaturation | 95 | 10 min. |
15 cycles | 95 | 30 sec. |
60◺50 | 45 sec. | |
68 | 120 sec. | |
20 cycles | 95 | 30 sec. |
50 | 60 sec. | |
68 | 120 sec. | |
extension | 68 | 9 min. |
hold | 10 | ∞ |