How Can We Help?

PCR REV pol 2500-3750

You are here:
< Back
REV PCR 2500-3075 Pro-RT
For PCR amplification of reticuloendotheliosis virus (REV) nucleotides 2500–3075 at the pol gene (protease and reverse transcriptase).

Forward primer: 5’•CAAATAATAGATTTTCTAGTAGATACGGGA3’
Reverse primer: 5’•AGTGGACGGGTCTCAGGA•3’

Extension temperature is dependent on polymerase
Step Temperature (°C) Time
initial denaturation 95 10 min.
15 cycles 95 30 sec.
60◺50 45 sec.
68 120 sec.
20 cycles 95 30 sec.
50 60 sec.
68 120 sec.
extension 68 9 min.
hold 10 ∞            
PCR-REV-pol-2500-3075-480px