How Can We Help?

PCR REV pol 4777-5575

You are here:
< Back
REV PCR 4777-5575 RT-Int
For PCR amplification of reticuloendotheliosis virus (REV) nucleotides 4777–5575 at the pol gene (reverse transcriptase and integrase).

Forward primer: 5’•CGAGAAGTAGCTATACGTCCTTTG3’
Reverse primer: 5’•ACATCGTGCCCGGAGC•3’

Extension temperature is dependent on polymerase
Step Temperature (°C) Time
initial denaturation 95 10 min.
15 cycles 95 30 sec.
60◺50 45 sec.
68 120 sec.
20 cycles 95 30 sec.
50 60 sec.
68 120 sec.
extension 68 9 min.
hold 10 ∞            
PCR-REV-pol-4777-5575-480px