LPDV p31/CA forward
- Sequence (5′ to 3′)
ATGAGGACTTGTTAGATTGGTTAC- Reverse complement (5′ to 3′)
GTAACCAATCTAACAAGTCCTCAT- Direction
- forward
- Target
- LPDV p31/CA
- Set
- PCR LPDV p31/CA
- Pairs with
- LPDV p31/CA reverse
- Length
- 24 nt
- GC content
- 37.5%
- Melting temperature estimate (Tm)
- 54.8 °C
- Annealing temperature
- Depends on the polymerase: NEB Tm Calculator
- Used in
The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.
In the literature
- Published in
- Allison et al. 2014, Virology 450-451:2-12
- Name in the paper
- Not found: The paper gives no primer names; it prints the two sequences in its methods.
- Sequence in the paper
ATGAGGACTTGTTAGATTGGTTACIdentical to the stored sequence.- Product in the paper
- Not found: The paper states no product size.
On the reference
- Reference
- U09568.1: Lymphoproliferative disease virus of Meleagris gallopavo Gag precursor, protease p16, Pol precursor, Env precursor, ORF1 and ORF3 genes, complete cds
- Position
- 1041 to 1064, + strand, no mismatches
- Product with LPDV p31/CA reverse
- 458 bp, 1041 to 1498
Positions and product sizes are computed from the sequence and the reference by the site’s own tested primer code, in the accession’s own coordinates, and are not copied from a paper. A primer is looked for exactly first, then with more mismatches up to 4, and any mismatch is shown.