REV and LPDV PCR primers
- Updated
- 2026-09-30
These are the PCR protocols my lab used to detect reticuloendotheliosis virus (REV) and lymphoproliferative disease virus (LPDV) in avian DNA, part of the REV and LPDV research on avian retroviruses. There are three REV primer sets, one in the 3′ LTR (long terminal repeat) and two in the pol gene, and one LPDV primer set in the p31/CA region. For a control that confirms a sample holds amplifiable bird DNA, see the pan-avian GAPDH PCR.
The REV and GAPDH protocols are the ones published in Stewart et al. 2019, J Wildl Dis 55(3), with the cycling in that paper's supplement. Cox et al. 2022, J Wildl Dis 58(4) used the same REV 3′ LTR and GAPDH cycling and added the LPDV set; its cycling is in that paper's supplement.
Reagents#
| Reagent | Stock | Amount | For 1 reaction | Notes |
|---|---|---|---|---|
| Nuclease-free water | 5.5 µL per reaction | 5.5 µL | ||
| One*Taq* Hot Start 2X Master Mix (New England Biolabs) | 12.5 µL per reaction | 12.5 µL | NEB OneTaq® Hot Start 2X Master Mix | |
| Forward primer (10 µM stock) | 10 µM | 1 µL per reaction | 1 µL | Cox et al. 2022 used primers at 200-400 nM final concentration. |
| Reverse primer (10 µM stock) | 10 µM | 1 µL per reaction | 1 µL | Cox et al. 2022 used primers at 200-400 nM final concentration. |
| Eluted DNA | 5 µL per reaction | 5 µL | Cox et al. 2022 used the same master mix in 25 µL reactions with 2 µL of eluted DNA. |
Equipment#
- NEB 100 bp ladder
- 2% agarose gel in TBE
Where the REV amplicons sit on the genome#
The original pages each showed a map of the REV provirus: LTRs at both ends, the primer binding site near the 5′ LTR, then gag (MA, R, CA, NC), pol (protease, reverse transcriptase, integrase) and env (SU, TM), on a scale of about 8 kb. The three amplicons sit as follows:
| Primer set | Region | Product on DQ387450 (computed) | Position on DQ387450 | Product (from the gel) |
|---|---|---|---|---|
| PCR REV 3′ LTR 8000-8297 | LTR | 282 bp | 8000-8280, and 258-538 in the 5′ LTR | 297 bp |
| PCR REV pol 2500-3075 | pol: protease and reverse transcriptase | 574 bp | 2492-3065 | 575 bp |
| PCR REV pol 4777-5575 | pol: reverse transcriptase and integrase | 801 bp | 4766-5566 | 798 bp |
The computed sizes come from the published primer sequences placed on GenBank DQ387450 (REV strain APC-566, 8,286 nt), the reference Stewart et al. 2019 compared their sequences against. The code that places them is tested, and it measures each product from one primer's 5′ end to the other's. Against DQ387450:
- 3′ LTR set: the forward primer has one base (a G) that the reference lacks, and the reverse primer one mismatch, so the product is one base longer than the 281 bases it spans. An LTR sits at each end of the provirus, so the same product can come from either one.
- pol 2500-3075: both primers match exactly.
- pol 4777-5575: the reverse primer has one mismatch.
The set names are the lab's rounded labels, not exact genome coordinates; "8297" in the LTR set's name is a label only, since the genome is 8,286 nt long. The gel sizes are read from the gel images on the original pages, beside a 100 bp ladder; each gel showed a band in the REV-positive lane and none in the negative lane. A gel reading is an estimate, and field strains can differ from DQ387450, so the two columns need not agree exactly.
Materials#
- NEB OneTaq® Hot Start 2X Master Mix
- NEB 100 bp ladder
- 2% agarose gel in TBE
Extension temperature is dependent on polymerase. The 68 °C extensions below are for the OneTaq mix.
Reaction mix#
From Stewart et al. 2019, for each 25 µL reaction:
| Component | Volume |
|---|---|
| Nuclease-free water | 5.5 µL |
| OneTaq Hot Start 2X Master Mix (New England Biolabs) | 12.5 µL |
| Forward primer (10 µM stock) | 1 µL |
| Reverse primer (10 µM stock) | 1 µL |
| Eluted DNA | 5 µL |
Cox et al. 2022 used the same master mix in 25 µL reactions with 2 µL of eluted DNA and primers at 200-400 nM final concentration.
Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of OneTaq Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.
Run the cycling program for the primer set, as in its table below.
Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder.
Expected:A band at the set's product size: see where the REV amplicons sit on the genome and, for LPDV, PCR LPDV p31/CA. On the original pages each gel showed a band in the REV-positive lane and none in the negative lane.
PCR REV 3′ LTR 8000-8297#
Amplifies a region of the REV 3′ LTR. Product: 282 bp computed on DQ387450; 297 bp read from the gel.
| Primer | Sequence (5′ to 3′) |
|---|---|
| Forward | CATACTGGAGCCAATGGTT |
| Reverse | AATGTTGTACCGAAGTACT |
| Step | Temperature (°C) | Time |
|---|---|---|
| initial denaturation | 95 | 5 min. |
| 35 cycles | 95 | 30 sec. |
| 47 | 45 sec. | |
| 68 | 60 sec. + 1 sec. per cycle | |
| extension | 68 | 10 min. |
| hold | 10 | ∞ |
The extension in each cycle is 68 °C, 60 s + 1 s per cycle: it starts at 60 s and grows by 1 s each cycle. This is the program in the supplements to Stewart et al. 2019 and Cox et al. 2022.
PCR REV pol 2500-3075 (protease and reverse transcriptase)#
Amplifies REV pol segment 2500-3075 (protease and reverse transcriptase). Product: 574 bp computed on DQ387450; 575 bp read from the gel.
The old site titled this set "PCR REV pol 2500-3750". The "3750" was an error: Stewart et al. 2019 give the segment as 2500-3075 in the main text and in the supplement, and the protocol text, genome map and gel on the old page agreed.
| Primer | Sequence (5′ to 3′) |
|---|---|
| Forward | CAAATAATAGATTTTCTAGTAGATACGGGA |
| Reverse | AGTGGACGGGTCTCAGGA |
| Step | Temperature (°C) | Time |
|---|---|---|
| initial denaturation | 95 | 10 min. |
| 15 cycles | 95 | 30 sec. |
| 60 to 50 (touchdown) | 45 sec. | |
| 68 | 120 sec. | |
| 20 cycles | 95 | 30 sec. |
| 50 | 60 sec. | |
| 68 | 120 sec. | |
| extension | 68 | 9 min. |
| hold | 10 | ∞ |
The first 15 cycles are a touchdown: the annealing temperature steps down from 60 to 50 °C over those cycles. Stewart et al. 2019 describe the program as a "touchdown PCR cycle (Barbosa et al. 2007)" and print the annealing as 60-50 °C in the supplement. The published protocol gives no step size. The next 20 cycles anneal at 50 °C.
PCR REV pol 4777-5575 (reverse transcriptase and integrase)#
Amplifies REV pol segment 4777-5575 (reverse transcriptase and integrase). Product: 801 bp computed on DQ387450; 798 bp read from the gel.
| Primer | Sequence (5′ to 3′) |
|---|---|
| Forward | CGAGAAGTAGCTATACGTCCTTTG |
| Reverse | ACATCGTGCCCGGAGC |
| Step | Temperature (°C) | Time |
|---|---|---|
| initial denaturation | 95 | 10 min. |
| 15 cycles | 95 | 30 sec. |
| 60 to 50 (touchdown) | 45 sec. | |
| 68 | 120 sec. | |
| 20 cycles | 95 | 30 sec. |
| 50 | 60 sec. | |
| 68 | 120 sec. | |
| extension | 68 | 9 min. |
| hold | 10 | ∞ |
The cycling is the same as for pol 2500-3075, as in the Stewart et al. 2019 supplement, including the touchdown from 60 to 50 °C over the first 15 cycles with no published step size.
PCR LPDV p31/CA#
Amplifies part of the LPDV gag polyprotein (partial p31/capsid). The primers are from Allison et al. 2014, Virology 450-451:2-12, designed on the Israeli prototype strain of LPDV (GenBank U09568). The cycling is from Cox et al. 2022 and its supplement. Use the reaction mix above.
| Primer | Sequence (5′ to 3′) | Length |
|---|---|---|
| Forward | ATGAGGACTTGTTAGATTGGTTAC |
24 nt |
| Reverse | TGATGGCGTCAGGGCTATTTG |
21 nt |
Product: 458 bp on U09568, positions 1041-1498, computed by placing both primers on the sequence (each matches exactly). The 413 nt between the primers is the partial p31/partial CA fragment Allison et al. 2014 analyzed.
| Step | Temperature (°C) | Time |
|---|---|---|
| initial denaturation | 95 | 3 min. |
| 34 cycles | 95 | 30 sec. |
| 54 | 30 sec. | |
| 68 | 60 sec. | |
| extension | 68 | 10 min. |
| hold | 10 | ∞ |
Related pages#
Expected results#
PCR REV 3′ LTR 8000-8297: 282 bp computed on DQ387450; 297 bp read from the gel. PCR REV pol 2500-3075: 574 bp computed on DQ387450; 575 bp read from the gel. PCR REV pol 4777-5575: 801 bp computed on DQ387450; 798 bp read from the gel. PCR LPDV p31/CA: 458 bp on U09568, positions 1041-1498, computed by placing both primers on the sequence. On the original pages each gel showed a band in the REV-positive lane and none in the negative lane, beside a 100 bp ladder.
Limitations#
A gel reading is an estimate, and field strains can differ from DQ387450, so the computed and gel sizes need not agree exactly. The touchdown in the two pol sets steps down from 60 to 50 °C over 15 cycles, and the published protocol gives no step size. Extension temperature is dependent on polymerase: the 68 °C extensions are for the OneTaq mix.
References#
Based on
- Stewart et al. 2019, J Wildl Dis 55(3): REV primer sets, reaction mix and REV cycling (cycling in the supplement)
- Cox et al. 2022, J Wildl Dis 58(4): REV 3′ LTR cycling (same as Stewart et al. 2019) and LPDV cycling (in the supplement)
- Allison et al. 2014, Virology 450-451:2-12: LPDV primer sequences
Cited
- Stewart et al. 2019, J Wildl Dis 55(3). doi:10.7589/2018-08-187. On this site: Stewart et al. 2019.
- Cox et al. 2022, J Wildl Dis 58(4). doi:10.7589/JWD-D-22-00023. On this site: Cox et al. 2022.
- Allison et al. 2014, Virology 450-451:2-12. doi:10.1016/j.virol.2013.11.037
- GenBank DQ387450 (REV strain APC-566, 8,286 nt) and U09568 (the Israeli prototype strain of LPDV).