REV and LPDV PCR primers: LTR, pol and p31/CA

Updated: 2026-09-30

These are the PCR protocols my lab used to detect reticuloendotheliosis virus (REV) and lymphoproliferative disease virus (LPDV) in avian DNA, part of the REV and LPDV research on avian retroviruses. There are three REV primer sets, one in the 3′ LTR (long terminal repeat) and two in the pol gene, and one LPDV primer set in the p31/CA region. For a control that confirms a sample holds amplifiable bird DNA, see the pan-avian GAPDH PCR.

The REV and GAPDH protocols are the ones published in Stewart et al. 2019, J Wildl Dis 55(3), with the cycling in that paper's supplement. Cox et al. 2022, J Wildl Dis 58(4) used the same REV 3′ LTR and GAPDH cycling and added the LPDV set; its cycling is in that paper's supplement.

Reagents#

Reagent	Stock	Amount	For 1 reaction	Source
Nuclease-free water		5.5 µL per reaction	5.5 µL	Not recorded
OneTaq® Hot Start 2X Master Mix		12.5 µL per reaction	12.5 µL	New England Biolabs, M0484
Forward primer (10 µM stock)	10 µM	1 µL per reaction	1 µL
Reverse primer (10 µM stock)	10 µM	1 µL per reaction	1 µL
Eluted DNA		5 µL per reaction	5 µL
100 bp DNA ladder				New England Biolabs, N3231

Primers#

Primer	Set	Direction	Sequence (5′ to 3′)	Length (nt)	Tm estimate (°C)	Product (computed)
REV 3′ LTR forward	PCR REV 3′ LTR	forward	`CATACTGAGCCAATGGTT`	18	51.7	281 bp at 2 sites
REV 3′ LTR reverse	PCR REV 3′ LTR	reverse	`AATGTTGTACCGAAGTACT`	19	50.7	281 bp at 2 sites
REV pol (protease and reverse transcriptase) forward	PCR REV pol (protease and reverse transcriptase)	forward	`CAAATAATAGATTTTCTAGTAGATACGGGA`	30	54.9	574 bp
REV pol (protease and reverse transcriptase) reverse	PCR REV pol (protease and reverse transcriptase)	reverse	`AGTGGACGGGTCTCAGGA`	18	59.1	574 bp
REV pol (reverse transcriptase and integrase) forward	PCR REV pol (reverse transcriptase and integrase)	forward	`CGAGAAGTAGCTATACGTCCTTTG`	24	57.2	801 bp
REV pol (reverse transcriptase and integrase) reverse	PCR REV pol (reverse transcriptase and integrase)	reverse	`ACATCGTGCCCGGAGC`	16	60	801 bp
LPDV p31/CA forward	PCR LPDV p31/CA	forward	`ATGAGGACTTGTTAGATTGGTTAC`	24	54.8	458 bp
LPDV p31/CA reverse	PCR LPDV p31/CA	reverse	`TGATGGCGTCAGGGCTATTTG`	21	59.8	458 bp

Product sizes are computed from where the primers bind DQ387450.1, DQ387450.1, DQ387450.1, U09568.1 (Reticuloendotheliosis virus strain APC-566, complete genome; Reticuloendotheliosis virus strain APC-566, complete genome; Reticuloendotheliosis virus strain APC-566, complete genome; Lymphoproliferative disease virus of Meleagris gallopavo Gag precursor, protease p16, Pol precursor, Env precursor, ORF1 and ORF3 genes, complete cds), in the accession’s own coordinates.

The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.

Equipment#

Equipment
2% agarose gel in TBE

Key resources#

Reagent or resource	Source	Identifier
Chemicals, peptides, and recombinant proteins
Nuclease-free water	Not recorded	Not recorded
OneTaq® Hot Start 2X Master Mix	New England Biolabs	Cat# M0484
100 bp DNA ladder	New England Biolabs	Cat# N3231
Oligonucleotides
REV 3′ LTR forward `5′-CATACTGAGCCAATGGTT-3′`	Not recorded	N/A
REV 3′ LTR reverse `5′-AATGTTGTACCGAAGTACT-3′`	Not recorded	N/A
REV pol (protease and reverse transcriptase) forward `5′-CAAATAATAGATTTTCTAGTAGATACGGGA-3′`	Not recorded	N/A
REV pol (protease and reverse transcriptase) reverse `5′-AGTGGACGGGTCTCAGGA-3′`	Not recorded	N/A
REV pol (reverse transcriptase and integrase) forward `5′-CGAGAAGTAGCTATACGTCCTTTG-3′`	Not recorded	N/A
REV pol (reverse transcriptase and integrase) reverse `5′-ACATCGTGCCCGGAGC-3′`	Not recorded	N/A
LPDV p31/CA forward `5′-ATGAGGACTTGTTAGATTGGTTAC-3′`	Allison et al. 2014, Virology 450-451:2-12	N/A
LPDV p31/CA reverse `5′-TGATGGCGTCAGGGCTATTTG-3′`	Allison et al. 2014, Virology 450-451:2-12	N/A

Where the REV amplicons sit on the genome#

The REV provirus has an LTR at each end, the primer binding site near the 5′ LTR, then gag (MA, R, CA, NC), pol (protease, reverse transcriptase, integrase) and env (SU, TM), over about 8 kb. Where each REV set binds the genome, and the size of its product, are computed from the primers and listed under Primers. An LTR sits at each end of the provirus, so the LTR product can come from either one. Each set gives a band in the REV-positive lane and none in the negative lane, beside a 100 bp ladder.

Materials#

2% agarose gel in TBE

Extension temperature is dependent on polymerase. The 68 °C extensions below are for the OneTaq mix.

Reaction mix#

From Stewart et al. 2019, for each 25 µL reaction:

Component	Volume
Nuclease-free water	5.5 µL
OneTaq Hot Start 2X Master Mix (New England Biolabs)	12.5 µL
Forward primer (10 µM stock)	1 µL
Reverse primer (10 µM stock)	1 µL
Eluted DNA	5 µL

Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of OneTaq Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.
Run the cycling program for the primer set, as in its table below.
Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder.
Expected:
A band at the set's product size: see where the REV amplicons sit on the genome and, for LPDV, PCR LPDV p31/CA. The REV-positive lane shows the band and the negative lane none.

PCR REV 3′ LTR#

Amplifies a region of the REV 3′ LTR.

Step	Temperature (°C)	Time
initial denaturation	95	5 min.
35 cycles	95	30 sec.
	47	45 sec.
	68	60 sec. + 1 sec. per cycle
extension	68	10 min.
hold	10	∞

The extension in each cycle is 68 °C, 60 s + 1 s per cycle: it starts at 60 s and grows by 1 s each cycle. This is the program in the supplements to Stewart et al. 2019 and Cox et al. 2022.

PCR REV pol (protease and reverse transcriptase)#

Amplifies the part of REV pol that spans protease and reverse transcriptase.

Step	Temperature (°C)	Time
initial denaturation	95	10 min.
15 cycles	95	30 sec.
	60 to 50 (touchdown)	45 sec.
	68	120 sec.
20 cycles	95	30 sec.
	50	60 sec.
	68	120 sec.
extension	68	9 min.
hold	10	∞

The first 15 cycles are a touchdown: the annealing temperature steps down from 60 to 50 °C over those cycles. Stewart et al. 2019 describe the program as a "touchdown PCR cycle (Barbosa et al. 2007)" and print the annealing as 60-50 °C in the supplement. The next 20 cycles anneal at 50 °C.

PCR REV pol (reverse transcriptase and integrase)#

Amplifies the part of REV pol that spans reverse transcriptase and integrase.

Step	Temperature (°C)	Time
initial denaturation	95	10 min.
15 cycles	95	30 sec.
	60 to 50 (touchdown)	45 sec.
	68	120 sec.
20 cycles	95	30 sec.
	50	60 sec.
	68	120 sec.
extension	68	9 min.
hold	10	∞

The cycling is the same as for the protease and reverse transcriptase set, as in the Stewart et al. 2019 supplement, including the touchdown from 60 to 50 °C over the first 15 cycles.

PCR LPDV p31/CA#

Amplifies part of the LPDV gag polyprotein (partial p31/capsid). The primers are from Allison et al. 2014, Virology 450-451:2-12, designed on the Israeli prototype strain of LPDV (GenBank U09568). The cycling is from Cox et al. 2022 and its supplement. Use the reaction mix above.

The product spans the partial p31/partial CA fragment Allison et al. 2014 analyzed.

Step	Temperature (°C)	Time
initial denaturation	95	3 min.
34 cycles	95	30 sec.
	54	30 sec.
	68	60 sec.
extension	68	10 min.
hold	10	∞

Expected results#

Each set gives a band at its product size, computed under Primers, in the REV-positive lane and none in the negative lane, beside a 100 bp ladder.

Limitations#

The touchdown in the two pol sets steps down from 60 to 50 °C over the first 15 cycles. Extension temperature is dependent on polymerase: the 68 °C extensions are for the OneTaq mix.

References#

Based on

Stewart et al. 2019, J Wildl Dis 55(3): REV primer sets, reaction mix and REV cycling (cycling in the supplement)
Cox et al. 2022, J Wildl Dis 58(4): REV 3′ LTR cycling (same as Stewart et al. 2019) and LPDV cycling (in the supplement)
Allison et al. 2014, Virology 450-451:2-12: LPDV primer sequences

Cited

Stewart et al. 2019, J Wildl Dis 55(3). doi:10.7589/2018-08-187. On this site: Stewart et al. 2019.
Cox et al. 2022, J Wildl Dis 58(4). doi:10.7589/JWD-D-22-00023. On this site: Cox et al. 2022.
Allison et al. 2014, Virology 450-451:2-12. doi:10.1016/j.virol.2013.11.037
GenBank DQ387450 (REV strain APC-566, 8,286 nt) and U09568 (the Israeli prototype strain of LPDV).

REV and LPDV PCR primers