COI primers LCO1490/HCO2198: sequences and PCR conditions

Updated: 2026-09-30

This is the PCR protocol my lab uses to amplify the mitochondrial cytochrome c oxidase subunit I (COI) gene from metazoan invertebrates with the LCO1490 and HCO2198 primers, often called the Folmer primers. It gives the primer sequences, the PCR conditions and the materials for COI barcoding PCR.

Reagents#

Reagent	Amount	Source	Notes
GoTaq® Flexi DNA polymerase		Promega, M8296
100 bp DNA ladder		New England Biolabs, N3231

Primers#

Primer	Set	Direction	Sequence (5′ to 3′)	Length (nt)	Tm estimate (°C)	Product (computed)
LCO1490	COI primers: LCO1490 and HCO2198	forward	`GGTCAACAAATCATAAAGATATTGG`	25	53	709 bp
HCO2198	COI primers: LCO1490 and HCO2198	reverse	`TAAACTTCAGGGTGACCAAAAAATCA`	26	57.6	709 bp

Product sizes are computed from where the primers bind X03240.1 (Drosophila yakuba complete mitochondrial sequence), in the accession’s own coordinates.

The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.

Equipment#

Equipment
1% agarose gel in TBE

Key resources#

Reagent or resource	Source	Identifier
Chemicals, peptides, and recombinant proteins
GoTaq® Flexi DNA polymerase	Promega	Cat# M8296
100 bp DNA ladder	New England Biolabs	Cat# N3231
Oligonucleotides
LCO1490 `5′-GGTCAACAAATCATAAAGATATTGG-3′`	Folmer et al. 1994, Molecular Marine Biology and Biotechnology 3(5):294-299	N/A
HCO2198 `5′-TAAACTTCAGGGTGACCAAAAAATCA-3′`	Folmer et al. 1994, Molecular Marine Biology and Biotechnology 3(5):294-299	N/A

What the primers amplify#

The primers amplify a region of the mitochondrial COI gene in metazoan invertebrates. Folmer et al. (1994) report the product as about 710 bp. In the lab's gels the product runs at about 708 bp beside a 100 bp ladder, with a band in the positive (mtDNA) lane and none in the negative lane.

The primers come from Folmer et al. (1994), who designed them to amplify this region of COI from a wide range of invertebrate phyla.

Reaction mix#

Set up the reaction with the mix recommended for your polymerase. The lab uses Promega GoTaq® Flexi DNA polymerase.

For reference, Folmer et al. (1994) published this 50 µL mix for Promega Taq: 1 µL template DNA, 4 U Taq polymerase, 5 µL 10x buffer, 5 µL MgCl2 (0.025 mol/L), 2.5 µL of each primer at 10 µmol/L, 5 µL dNTP mix as in Folmer, and 29 µL water.

PCR conditions#

This is the lab's cycling program. Folmer et al. (1994) used 35 cycles of one minute at 95 °C, one minute at 40 °C and one and a half minutes at 72 °C, followed by 72 °C for seven minutes.

Extension temperature is dependent on polymerase.

Step	Temperature (°C)	Time
initial denaturation	94	30 sec.
20 cycles	94	30 sec.
	56 to 46 (touchdown)	30 sec.
	72	1 min.
20 cycles	94	30 sec.
	46	30 sec.
	72	1 min.
extension	72	10 min.
hold	10	∞

The first 20 cycles are a touchdown: the annealing temperature steps down from 56 to 46 °C over those cycles. The second block of 20 cycles anneals at 46 °C.

Run the product on the 1% agarose gel in TBE beside the 100 bp ladder and look for the band at 708 bp.
Expected:
The product at 708 bp, next to the 100 bp ladder, in the positive (mtDNA) lane, with no band in the negative lane.

In this lab#

In this lab, COI has been run on insect DNA ahead of the Wolbachia 16S PCR, so that a sample with no Wolbachia band can be told apart from a sample with no amplifiable DNA.

Expected results#

Folmer et al. (1994) report the product as about 710 bp. In the lab's gels the product runs at about 708 bp beside a 100 bp ladder, with a band in the positive (mtDNA) lane and none in the negative lane.

References#

Based on

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299.: primer sequences
the lab's written protocol: cycling program

Cited

Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294-299. PDF

COI primers: LCO1490 and HCO2198