Pan-avian GAPDH primers: avian GAPDH PCR control

Updated: 2026-09-30

This is the PCR protocol my lab uses to amplify pan-avian GAPDH (glyceraldehyde-3-phosphate dehydrogenase). It serves as a control for avian DNA: a GAPDH band shows that a bird DNA extraction holds DNA that will amplify, so a negative result in a virus PCR such as the REV PCR can be trusted.

Reagents#

Reagent	Stock	Amount	For 1 reaction	Source
Nuclease-free water		5.5 µL per reaction	5.5 µL	Not recorded
OneTaq® Hot Start 2X Master Mix		12.5 µL per reaction	12.5 µL	New England Biolabs, M0484
Forward primer (10 µM stock)	10 µM	1 µL per reaction	1 µL
Reverse primer (10 µM stock)	10 µM	1 µL per reaction	1 µL
Eluted DNA		5 µL per reaction	5 µL
100 bp DNA ladder				New England Biolabs, N3231

Primers#

Primer	Set	Direction	Sequence (5′ to 3′)	Length (nt)	Tm estimate (°C)	Product (computed)
Pan-avian GAPDH forward	Pan-avian GAPDH PCR	forward	`GTGGTGCTAAGCGTGTTATCATC`	23	58.6	534 bp
Pan-avian GAPDH reverse	Pan-avian GAPDH PCR	reverse	`GGCAGCACCTCTGCCATC`	18	60.8	534 bp

Product sizes are computed from where the primers bind NC_052532.1:76902320-76906237 (Gallus gallus isolate bGalGal1 chromosome 1, bGalGal1.mat.broiler.GRCg7b, whole genome shotgun sequence), in the accession’s own coordinates.

The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.

Equipment#

Equipment
2% agarose gel in TBE

Key resources#

Reagent or resource	Source	Identifier
Chemicals, peptides, and recombinant proteins
Nuclease-free water	Not recorded	Not recorded
OneTaq® Hot Start 2X Master Mix	New England Biolabs	Cat# M0484
100 bp DNA ladder	New England Biolabs	Cat# N3231
Oligonucleotides
Pan-avian GAPDH forward `5′-GTGGTGCTAAGCGTGTTATCATC-3′`	Olias et al. 2014, PLoS ONE	N/A
Pan-avian GAPDH reverse `5′-GGCAGCACCTCTGCCATC-3′`	Olias et al. 2014, PLoS ONE	N/A

Where the primers come from#

The primers are from Olias et al. 2014 (PMC4057121). The protocol on this page is the one published in Stewart et al. 2019, J Wildl Dis 55(3), with the cycling in that paper's supplement; Cox et al. 2022 used the same cycling.

Product size#

The product size is computed under Primers, from where the primers bind the chicken genome. In the lab's gels the product runs at that size beside a 100 bp ladder, with DNA from DF-1 cells as the positive control and no band in the negative lane.

Materials#

2% agarose gel in TBE

Reaction mix#

From Stewart et al. 2019, for each 25 µL reaction:

Component	Volume
Nuclease-free water	5.5 µL
OneTaq Hot Start 2X Master Mix (New England Biolabs)	12.5 µL
Forward primer (10 µM stock)	1 µL
Reverse primer (10 µM stock)	1 µL
Eluted DNA	5 µL

Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of OneTaq Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.

PCR conditions#

Extension temperature is dependent on polymerase. The lab runs the extension at 68 °C for the OneTaq mix, where Olias et al. 2014 used 72 °C.

Step	Temperature (°C)	Time
initial denaturation	95	10 min.
40 cycles	95	30 sec.
	58	60 sec.
	68	30 sec.
extension	68	5 min.
hold	10	∞

Run the cycling program in the table above.
Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder and look for the band at the product size listed under Primers.
Expected:
A band at the product size listed under Primers in the positive control (DNA from DF-1 cells) and no band in the negative lane.

Expected results#

A band at the product size computed under Primers, beside the 100 bp ladder. In the lab's gels the product runs at that size, with DNA from DF-1 cells as the positive control and no band in the negative lane.

Limitations#

Extension temperature is dependent on polymerase: the lab runs the extension at 68 °C for the OneTaq mix, where Olias et al. 2014 used 72 °C.

References#

Based on

Olias et al. 2014: primer sequences
Stewart et al. 2019, J Wildl Dis 55(3): reaction mix and cycling (cycling in the supplement)
Cox et al. 2022: same cycling

Cited

Olias et al. 2014. PMC4057121
Stewart et al. 2019, J Wildl Dis 55(3). doi:10.7589/2018-08-187. On this site: Stewart et al. 2019.
Cox et al. 2022. doi:10.7589/JWD-D-22-00023. On this site: Cox et al. 2022.

Pan-avian GAPDH PCR