Dustin Edwards

Pan-avian GAPDH PCR

Updated
2026-09-30

Printable sheetMarkdown

This is the PCR protocol my lab uses to amplify pan-avian GAPDH (glyceraldehyde-3-phosphate dehydrogenase). It serves as a control for avian DNA: a GAPDH band shows that a bird DNA extraction holds DNA that will amplify, so a negative result in a virus PCR such as the REV PCR can be trusted.

Reagents#

ReagentStockAmountFor 1 reactionNotes
Nuclease-free water5.5 µL per reaction5.5 µL
One*Taq* Hot Start 2X Master Mix (New England Biolabs)12.5 µL per reaction12.5 µLNEB OneTaq® Hot Start 2X Master Mix
Forward primer (10 µM stock)10 µM1 µL per reaction1 µL
Reverse primer (10 µM stock)10 µM1 µL per reaction1 µL
Eluted DNA5 µL per reaction5 µL

Equipment#

  • NEB 100 bp ladder
  • 2% agarose gel in TBE

Primer sequences#

Primer Sequence (5′ to 3′)
Forward GTGGTGCTAAGCGTGTTATCATC
Reverse GGCAGCACCTCTGCCATC

The primers are from Olias et al. 2014 (PMC4057121). The protocol on this page is the one published in Stewart et al. 2019, J Wildl Dis 55(3), with the cycling in that paper's supplement; Cox et al. 2022 used the same cycling.

Product size#

Olias et al. 2014 give the genomic product as 534 bp. The gel shown on the original version of this page marked the product at 534 bp, next to a 100 bp ladder. The positive lane was DNA from DF-1 cells; the negative lane had no band.

Materials#

Reaction mix#

From Stewart et al. 2019, for each 25 µL reaction:

Component Volume
Nuclease-free water 5.5 µL
OneTaq Hot Start 2X Master Mix (New England Biolabs) 12.5 µL
Forward primer (10 µM stock) 1 µL
Reverse primer (10 µM stock) 1 µL
Eluted DNA 5 µL

  1. Set up each 25 µL reaction as in the table: 5.5 µL of Nuclease-free water, 12.5 µL of OneTaq Hot Start 2X Master Mix (New England Biolabs), 1 µL of Forward primer (10 µM stock), 1 µL of Reverse primer (10 µM stock) and 5 µL of Eluted DNA.

PCR conditions#

Extension temperature is dependent on polymerase. The lab runs the extension at 68 °C for the OneTaq mix, where Olias et al. 2014 used 72 °C.

Step Temperature (°C) Time
initial denaturation 95 10 min.
40 cycles 95 30 sec.
58 60 sec.
68 30 sec.
extension 68 5 min.
hold 10 ∞

  1. Run the cycling program in the table above.

  2. Run the product on the 2% agarose gel in TBE beside the NEB 100 bp ladder and look for the band at 534 bp.

    Expected:

    A band at 534 bp. On the original version of this page, the positive lane (DNA from DF-1 cells) showed the product at 534 bp and the negative lane had no band.

Expected results#

A band at 534 bp beside the 100 bp ladder. Olias et al. 2014 give the genomic product as 534 bp. The gel shown on the original version of this page marked the product at 534 bp; the positive lane was DNA from DF-1 cells, and the negative lane had no band.

Limitations#

Extension temperature is dependent on polymerase: the lab runs the extension at 68 °C for the OneTaq mix, where Olias et al. 2014 used 72 °C.

References#

Based on

Cited