Primers

The primers the lab’s protocols use, with each sequence as stored. Length, GC content and melting temperature are computed from the sequence, and a pair’s product is computed from where its primers bind a reference sequence.

Search primers

Sort

Filters

12 primers

Primer	Sequence (5′ to 3′)	Direction	Target	Length (nt)	Tm estimate (°C)	Product (computed)
HCO2198	`TAAACTTCAGGGTGACCAAAAAATCA`	reverse	COI (cytochrome c oxidase subunit I)	26	57.6	709 bp
LCO1490	`GGTCAACAAATCATAAAGATATTGG`	forward	COI (cytochrome c oxidase subunit I)	25	53	709 bp
LPDV p31/CA forward	`ATGAGGACTTGTTAGATTGGTTAC`	forward	LPDV p31/CA	24	54.8	458 bp
LPDV p31/CA reverse	`TGATGGCGTCAGGGCTATTTG`	reverse	LPDV p31/CA	21	59.8	458 bp
Pan-avian GAPDH forward	`GTGGTGCTAAGCGTGTTATCATC`	forward	GAPDH	23	58.6	534 bp
Pan-avian GAPDH reverse	`GGCAGCACCTCTGCCATC`	reverse	GAPDH	18	60.8	534 bp
REV 3′ LTR forward	`CATACTGAGCCAATGGTT`	forward	REV 3′ LTR	18	51.7	281 bp at 2 sites
REV 3′ LTR reverse	`AATGTTGTACCGAAGTACT`	reverse	REV 3′ LTR	19	50.7	281 bp at 2 sites
REV pol (protease and reverse transcriptase) forward	`CAAATAATAGATTTTCTAGTAGATACGGGA`	forward	REV pol	30	54.9	574 bp
REV pol (protease and reverse transcriptase) reverse	`AGTGGACGGGTCTCAGGA`	reverse	REV pol	18	59.1	574 bp
REV pol (reverse transcriptase and integrase) forward	`CGAGAAGTAGCTATACGTCCTTTG`	forward	REV pol	24	57.2	801 bp
REV pol (reverse transcriptase and integrase) reverse	`ACATCGTGCCCGGAGC`	reverse	REV pol	16	60	801 bp

The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.