HCO2198
- Sequence (5′ to 3′)
TAAACTTCAGGGTGACCAAAAAATCA- Reverse complement (5′ to 3′)
TGATTTTTTGGTCACCCTGAAGTTTA- Direction
- reverse
- Target
- COI (cytochrome c oxidase subunit I)
- Set
- COI primers: LCO1490 and HCO2198
- Pairs with
- LCO1490
- Length
- 26 nt
- GC content
- 34.6%
- Melting temperature estimate (Tm)
- 57.6 °C
- Annealing temperature
- Depends on the polymerase: NEB Tm Calculator
- Used in
The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.
In the literature
- Published in
- Folmer et al. 1994, Molecular Marine Biology and Biotechnology 3(5):294-299
- Name in the paper
- HCO2198
- Sequence in the paper
TAAACTTCAGGGTGACCAAAAAATCAIdentical to the stored sequence.
On the reference
- Reference
- X03240.1: Drosophila yakuba complete mitochondrial sequence
- Position
- 2173 to 2198, - strand, no mismatches
- Product with LCO1490
- 709 bp, 1490 to 2198
Positions and product sizes are computed from the sequence and the reference by the site’s own tested primer code, in the accession’s own coordinates, and are not copied from a paper. A primer is looked for exactly first, then with more mismatches up to 4, and any mismatch is shown.