Pan-avian GAPDH forward
- Sequence (5′ to 3′)
GTGGTGCTAAGCGTGTTATCATC- Reverse complement (5′ to 3′)
GATGATAACACGCTTAGCACCAC- Direction
- forward
- Target
- GAPDH
- Set
- Pan-avian GAPDH PCR
- Pairs with
- Pan-avian GAPDH reverse
- Length
- 23 nt
- GC content
- 47.8%
- Melting temperature estimate (Tm)
- 58.6 °C
- Annealing temperature
- Depends on the polymerase: NEB Tm Calculator
- Used in
The melting temperature (Tm) is an estimate for comparing primers with each other, computed from the sequence with the SantaLucia (1998) unified nearest-neighbour model (SantaLucia J Jr (1998), Proc Natl Acad Sci USA 95:1460-1465) at 50 mM monovalent cation and 0.5 µM primer. These are standard reporting conditions, not those of any one reaction buffer. A sequence with an ambiguity code has no single Tm and shows none. The Tm estimate is not an annealing temperature. For the annealing temperature of a particular polymerase, use the NEB Tm Calculator.
In the literature
- Published in
- Olias et al. 2014, PLoS ONE
- Name in the paper
- Not found: The paper gives no primer names; its Table 1 lists the pair under the gene symbol GAPDH, as forward and reverse.
- Sequence in the paper
GTGGTGCTAAGCGTGTTATCATCIdentical to the stored sequence.- Product in the paper
- 534 bp, equal to the computed size
On the reference
- Reference
- NC_052532.1:76902320-76906237: Gallus gallus isolate bGalGal1 chromosome 1, bGalGal1.mat.broiler.GRCg7b, whole genome shotgun sequence
- Position
- 76904235 to 76904257, + strand, no mismatches
- Product with Pan-avian GAPDH reverse
- 534 bp, 76904235 to 76904768
Positions and product sizes are computed from the sequence and the reference by the site’s own tested primer code, in the accession’s own coordinates, and are not copied from a paper. A primer is looked for exactly first, then with more mismatches up to 4, and any mismatch is shown.